GenePrediction:GLEAN_2785 Details

Name: GLEAN_2785
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3221986..3222693 (+ strand)
Length: 708
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3221986..3222018 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_140:3222082..3222165 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_140:3222226..3222693 (+ strand)
Length: 468
>GLEAN_2785 class=GenePrediction position=GCSC_140:3221986..3222693 (+ strand)
ATGTCGCTCGATCTGGAGAAACACCTCGTCTTTGTAAGTTGTCCTTGCGAGAAGCTCCGACGGCGAGATCGCCCGGACTG
ACTCTTCTGCCTTTAGTATGGCGCATACCACAACGACAAGATCAATCAGGGCATTCACATGGTCTGCGTGCCCATCATCC
TCGGCTCCGGCTTCTGGGTCGTATGTATACGTTCTTTCTCTCTCATACTCTTCTCCTCAACTGACTCTCAATTGACGCAG
GCTGCCAATTCTCCCACAATCATCCCCCTTCCCGCCTGCCTTACCGTCACCAACCTGCAGCTCAATCTCTGCACGCTCGG
CTCGCTGATCTGGGGTGGTCTCTACGTCCTCCTCGAGCCTGTCGCCGGCACCGCCCTCGCTCTCCTCTGTGTTGGTTCCG
CTGCCGCCGGCAACTACGCCTACGCGCATTACGACGCCTACACGCTCACCACCTATGCCCTGGCTGCCCACATCGTCTGC
TGGATCCTGCAGTTTGTCGGCCACGGCAAGTTTGAGCGTCGTGCCCCGGCCCTGTTCGACAGCCTCTTTCAGGCCATCTT
CTTGGCTCCGCTGTTCGTCTGGCTGAAGCTGCTGTTCGCTTTTGGCTACCGCCAGGAGCTGCAGGGCCGCGTCGATCGGG
ACGTGCGAAAGGCCGTTGCCAAGTACCGGATGTCTCGGAATGCCACGGCGAACGGCACGGCCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62