GenePrediction:GLEAN_2786 Details

Name: GLEAN_2786
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3224916..3229319 (+ strand)
Length: 4404
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3224916..3225553 (+ strand)
Length: 638
Type: CDS
Source: GLEAN
Position: GCSC_140:3225851..3229319 (+ strand)
Length: 3469
>GLEAN_2786 class=GenePrediction position=GCSC_140:3224916..3229319 (+ strand)
ATGAGTAATGCGCCACTTACTATTGCTGCCAAGGCTGGCAATGTTAATGACTTGGCGGAGGCGTTAGCTGCCGGCGGCAT
CGATTTTAACCAGCGCGACGACGATGGCCGCACGCTACTGTCGTACGCTGCCGAGGGCGGCCACATCGCCGTGGTAGAGC
GGCTGCTTATTGCAGGCGCCGGCGACATTGACCTAAACCAGCGCGACCTTGATAACTGCACGTTACTGTCGTACGCTGCC
GAGGGCGGCCACATTGCCGTGGTAGAGCGGCTGTTTATTGCAGGCGCCGGCGATATCGACATTAACCAGCGCGACTACAA
TCGCCGCACAGCACTATCGTACGCTGCTAAGGGCGGCCACATCGCCGTGGTAGAGCGGCTGCTTATTGCAGGCGCCGGTG
ACATCGAAATTAACCAGCGCGAACGTCATGGCCGCACGGCACTGTCGTACGCTGCCGAGGGCGGCCACATCGCCGTGGTA
GAGCGGCTGCTTCTTGCAGGCGCCGGCGACATCGACATTAACCAGCGCGAACGTTATGGCCGCACAGCACTATCGTACGC
TGCTAAGGGCGACCACATCGCCGTGGTTCGGCTGCTGCTTGCTGTGGGCGCTGACCCTAACCTGCGAGACCTTAATATGT
TAACGCCGCTATGGTTCGCGGCATTGAAAGGCTGCACAGCGGTTGTTAAGCTGTTGTTAGAGTGTGGTCTAACTGACGTG
AACCCGTGGTCTGGTCGCATCTATGAAAATAGATTTGAGACCCCCCTTGCCCTCGCCTTGAAGAATCGCCACCAAGAGAC
GGCCTAGCTGCTGGCCCACGCAGACGGCATCGACGCCCTCCTAATATTAGGCGACGACTATTCCCCAAGCGTGCTAGGAC
TGGCCATTGAGTCCGGATACCAAGAAGTGGCCTTAACCCTACTCCTTAAGTGTAGGGGAAGGTTGGAACGGAGCGCTGCA
CCCCTGAGCGGCGACCGCGATGTTGCCGTTGAGTCGGCTTCGCGGCTGTTGGTCTATGCCTCTAGCGCCAACTGCCTTCG
AGTCGCCGACGAGCTTTTGAAAAAGCATGGCGCAGACGTGAATGCGGTCTGTCGATGTGGACCGTTCGATCTTAGTCCAC
TCATGGCGGCTTCTAAGAAGGGCAACGCAGAATCAGTCAGCTTTCTCCTTACGATAGAAGGGATCCTGCCAAACGTCTTC
AATAGCGATGGTTCTACGGCACTTATCCTAGCGAGCATTGAGGGGTTTGTCGACGTGGTCAAGATGCTCGTATCCGACGA
GAGGGTGACTGTTGACCAAAGTGACAAGAAAGGGCGCACTGCTTTATCACATGCAGCCGAGCATGCTCGCGAGGACGTGG
TGGCCGTGCTGTTGGACACCGGCCGGCTTGACACCAACTCCAGGGATCAGAATGGCCGCACACCACTGGCTTATGCCGCT
GGGTCGAAAAGGAAGAACGCCGTTAACGCCGTTCGACTGCTACGGAACGTTTCGTCGACTGAGCAAAACCCAATGGACCA
CGATGGAAACACTCTGCTGATTATTGCTGCCGCTTGCGGCAACGCGAAAATGGTCGATCTGCTTCTTACGGGATCGACAA
GCATCGACATCAATCTACAGAACCGACAAGGCATGTCAGCACTACACAGGACGGCCAGGTCGAGTCTAAGTGATTCGGAG
GAGGAAAGCGACTCGGAGGAAGAAAACGACTCGGAGGAAGAATCAGATTGGGCAGAGGTAATGCGAGCACTTATCGCCGT
CTCCGGCATCAAAGTCAACATTGAAGACCGTATGAAACGGACGGCGCTCTCTTACGCGGCAGAGGGTGGCAATCTCAAAC
TAGTTGAAATTCTTCTTAAAGCCGACGGTGTTGATCCAGACTTGAACGCGGACGGCCGAAGCCCGTTATCGTGGGCGTTG
CCTAAGACTGCCGACAGTCAGGAGTTGACAAAACGGCGTGAAGAAGTGGTGCGGCTGCTTTTAAGCAACTCGAATGTGGA
CCCGAATGCAGAAGACGCCGAAGGGCTGACACCGCTGATTCGGGCGATCCAGTGTCGTAACCGTGTCAAGTGTGTCGAGC
TGATGCTCGAACGCCCAGACCTCGACGTGAACCAACAGGGACGGAATGGTCTCAGTCCTCTGGCCGTGGCAGAAGAGATC
GACGACACGATTGTCATTGAGATTTTGCGCAGCCGTGGCGCGACCGCACCGGAGAGGCCTTTGTTGGATGCCAACAGTCA
AATTAATGTTGAAGGCTCGCCCGATAATAGCATGGTACTCAGTAAAGGGGGCCGCATATCCCTAGGCACACAGCAGGAAT
ACATCGACGAGTGGGCGGACGGCACAGAAATACTGTGTAGATACTGCTCGGAGATCGATCTAGATGATGCCTTTTCAAAT
CACGACTACAGAGAGCGCATGCATTCTTTGGAAGGTGAATCACTGTGTCCTTTGTGTCGTCTGTTAATAGCGGTGGATAG
ACAATACCTCTGGGACGTTCACTTGATAAGCAACTCGAGCACGCAAGGCTGGATCTGCGGTAAAATGTTTTTGGAAGCTT
TAGAGTCTTTGGAGGCCCCTTGGTTTGACACTATGGTGCTTGCCATTGGCGGTTCTGGGTGGGAATATACGGGCGACATT
TTATCCACCGGCATGATCGGCCGCCTTGGATCAAATTGCCCGGAAAAGAAGTACGCCATAACAATCCCACGTTTGCTGGG
TACGGATGAGGGGAGTGCTGCACGCATGAGGACAGCCAGAGAATGGATTTCGACTTGTATAAAACACAAGGAGTGCAACC
CTCCGGACAAATTCGCTATACCGCCACATCTATACCTTATCGACTGCAAAAAGCGGCGCATCATAAACCAGCACGAGTTC
GAGGGTACCTGGCCGCCGTCATACGTTGCATTGAGCTACGTCTGGCGCCTGTCTCCGGTTGATGAGCCGCATCTAGACGA
TTTAGGTGGCGATGTGGCGGCTGTCATCAAAGACGCTATTAACGTGACTCTTGAGCTCGGCTACGAATACCTGTGGATCG
ACCGGTACTGCATCGTACGGGAGAAGGGCTATGACGCTGTTAAGAACGAACAAATGCGGCACATGCACCCCGTCTACCTC
AACGCCGAGGTGACCCTGGTGGCAGCCGCTGGCGAAGACGCATCAGCTGGCCTACCCGGTGCACCAGGACGTCCAAGATC
CTACCAGCAGCCCGGGGCTTTCATCAAGGGCCACAAACTCGTCGTCATTCCTCCTGACCCCTATACAGTTATCAAAGACT
CGACCTGGGATTCGCGCGGCTGGACCCTCCAGGAGGGCTTGCTCGCACGCCGTCGTCTCTACTTTACCGACTACGAGATG
TCGTACGGGTGTCGCAATATGCTTTGTCGCGAAGCCATACAGCTTCCACCCGGCCGAGAACGGAAAATACACAAACACAA
ACCGAGTACGCGGGAGCCGTTGTGGATGCATGACTCCTGGCAACTGGCCGAGAACGCCGTCAAACATGGTGCCAGCGGCA
TCTTTCGTCTTTTAGGGGACTACACAAAGCGACAGCTGTCCTTCCAGAAAGACGCCCTGAATGCTATACTTGGCGTCCTT
CAACTTCTTGCCGATAACAAGGAACCGCTGTACCACGTATGTGGCGTTCCTATACTGAGAGATTTTGAAGACAAGGAAAA
AGAAGAAGACAAGGAAAAAGAAAATGATGCCGCCCTCACCGGTTTTGTTAACGGACTCTGCTGGACTCTCAAGCGTCCGA
CTCGTCGGCGGCTCGGATTTCCGACTTGGTCATGGACCGGATGGACGGGACAGGTCGACGATCGTGGCTTAATTGTTGAC
CAAGCACCTTTCAAAACGTCTCTAAACCTCTCCATTGTTCCTCGTGATGGAAAAGGCGGTTCTGGCGTTGCCCTACCATG
GGAAATCTACTACGGCTTACGGCACGAAACAGACGACCACAACAAGGCCACCTGGTCCGGTCAAACTCACATGTTTGAGA
TCACAGCTGCTGCAGCCACAGTTCAGATTCACGCTTCGTATAGCTATCATGGCATGGTGTGCGTTGGTGACCGTGTGTGG
AAGGGTCGATTCAAGCTCACTTGGAACGGCGGCGACGGTAGCGACGACGACAGGAAAAGGAACGATGACCGTGTTACCGA
CTCTCTGGAGACGGCGCTATTTCAGAAGCCATGGGAAGGCACTGTGCTTGGAGCATCAACACCCTCCCCTCCCGAAGATG
AGTCTCCCTATACTTATGTGCTCGTCGTTCAGAAGCAGCAGCAGACAAATGAACAGTTGCCTCCCAACGCCCAAACGCGC
TGGGAGCGCCTTGGTATTCTACGGCTTGAACGCTGCGAGCTAGAGGAAGACATGTTGGAACGGAAAACTTGGTTGATTGT
GTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62