GenePrediction:GLEAN_2787 Details

Name: GLEAN_2787
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3235280..3236824 (+ strand)
Length: 1545
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3235280..3235804 (+ strand)
Length: 525
Type: CDS
Source: GLEAN
Position: GCSC_140:3235859..3236741 (+ strand)
Length: 883
Type: CDS
Source: GLEAN
Position: GCSC_140:3236802..3236824 (+ strand)
Length: 23
>GLEAN_2787 class=GenePrediction position=GCSC_140:3235280..3236824 (+ strand)
ATGTCTGCCTCTCCCCAGCACACCTCGACCAAGCGTCCTCTCGAGGACGTCTCGTCGCCCTCTAGAACCGGCGATCAGCC
CGACGCAAAGCGACCTGCTCTCGACAAGGTCGTGCGGAACGACGGCGAGATACGCAAGGAGACCAATGGCCTTCCTGCTA
TCCCGCCCATCCCCATCGCCGACTCGAACGGCACCAACGGCACCAACGGTGCCAAGAAGGACACCAAGGACGGCGAGGAT
GAGCCTACGGCCGAAAGCACCGAAAGCAAGGCCATTGCCAGCACAGCCAGCAGCAACACAGCTCCGTCGCAGACTGCTCC
CGCAAACGCCCACGACGAGACATCCTGGATCCACATTCGCGCCGTCATTTCCAGCCCCGAGGCTGCCACCATCATCGGCA
AGGGTGGTGAGAACGTCTCCAAGATCCGCCAGATGTCCAACGCAAAGTGCACCGTCAGCGACTACCAGAAGGGCGCTGTC
GAGCGCATCCTGACGGTCAGCGGCGTGGTGGATGCTGTTGCAAAGGTAAGACAGCCCTGCGCCGTCTCTATCAGCTTGTC
TCCCTGCTAACATCGGCAGGCATTCGGCCTCATCATCCGCACATTGAACAACGAGCCGCTGGGCGAGCCGTCGAATGCGC
ACTCAAAAACCTACCCTCTTCGCCTGTTGATTCCTCACATCCTGATCGGCTCCATCATCGGAAAGGGCGGCTCCCGGATT
AAGGAGATCCAGGAGGCATCTGGTGCGCGCCTGAACGCGTCGGACTCCTGCCTTCCCATGTCTTCCGAGCGGTCGCTCGT
CGTTATGGGCGTCGCAGATGCCGTTCACATTGCTACTTACTATGTGGGCAGCACTCTGCTGGAGCAGCTGAACGAGCGCT
TCGGTGGCCCGGCCGCCTCAGCCTATGCTGCCCGTGGCGGCGGCCCTGTTGGCGTCGTCCCCGGTGGCATGCAGGTCGTC
CCCTACCTCCCCCAGCCTGCTGGTGGAAGCTACGGCAGAACCGAGAACTACAGCCGTCGCCAGGATCCCCGTGCTCAGCT
GCCGCCCCAAGGATACGGTGCTCCATACGGTGCTCCCATTGCCCACGGTCCGGGTCCTGCAGTCCCCATGTACGGCGCCC
AGGCAGCTGGAGCCTACGGAGCGCCGCAGCTGCCGCACCAGAATGCCGCTCATCACGGTGCTATGCCTCACGGTCCCCAT
GCTGGTCAGCCGCCACACGCTGGCCCAGGTGGCCACCCTGCCATGGCTGGTGCGCCCTTGACACAGCAAATCTACATCCC
GAACGATATGGTCGGAGCTATCATTGGCAAGGGTGGCCAGAAGATCAACGAGATCCGGCAGGTTTCGGGCAGTGTTATCA
AGATCAACGAGCCGCAGGACAACAGCAATGAGCGTCTTGTGACCATCACAGGCACTGAGGAGTGCAACCGCATGGCGCTG
TACATGCTCTACTCTCGTCTTGGTAAGCCGGACACCCCCATTCCACAGTCTCACGGCGTTGCTAATCATTCTATCGTACC
AGAGAGCGAAAAGCACCGGACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62