GenePrediction:GLEAN_2792 Details

Name: GLEAN_2792
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3266711..3267717 (+ strand)
Length: 1007
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3266711..3266751 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_140:3266818..3266848 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_140:3266913..3267035 (+ strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_140:3267090..3267257 (+ strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_140:3267365..3267517 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_140:3267571..3267717 (+ strand)
Length: 147
>GLEAN_2792 class=GenePrediction position=GCSC_140:3266711..3267717 (+ strand)
ATGAAGAACCCAAAATTTGGCGGCATCCAGTACGAGAACAGGTAAGTCTTTGAGCCCCAATAAACAGTTGATTGCACGAA
GACGTGGATGGCCAATATGCACATTAGGCATCCCGGAATGGCATGTGATCTGCCCGGTGTCTGTATGCTCTACGCTGTCT
CTCCTGGCCAGTGGGCCGGGTTGACTAATTGCAGCATACCAGTGTACGTTTAAGGACTACACGCAATGGCCCGAATTTTA
CTCAGCCGGCCAGGACATCTTGGCGTACATCAAGTGTGTGGCCGAAAAGTACCACATAGACCGCTACCTCAAGCTGCAGA
ACGAGGTGATCGGTGCCGACTGTAGCGATGCGTCGGCAAAGTAGACACTGCACGTCCAGGACCTAACGGCCGGCACGGTG
TATGCCAACAAGTGCGGCTTTCTCGTCGTTATCCTAAGCCTGCATAACTTCAATGGACGGCAAATGCACACGGCCAACTT
GGACGAGCCGTACGACATCGAGGATAAGGAGGTCATCGTCAACGGCAGCGACTCATCGGCTCTCCAGGTTATTCCGACCT
TCCAGCCCAAAGTAGCCCAAAGTGAAGCGGCTGGACAATTACATGCAATCCAAAAAAGTGGATTGCCTCAAGCCCCCGAT
TGCGGGAACTGTAGGTTGAGCCTGCGCATCGTGCAGCCTGTCGAGTCCCCGTGCTCACCGACGGCATCGAGACCATCGAC
GGCAAAGTGCGCAAGGTCGACACCATCGTCACGGATACCGGCTTCGACTCCTACCTGCCGCGCTTCCCCATCACCGGCAC
CGGCGGTGTGCTGCATCTAGGAAGCTCCCCGAGGCCTATGCTAGCATCCTTGCCGATAAGATGCCCAGTTTCTTCCTCTC
GCTCGGCCCCGACAGCACTCCACCCACCGGCTCGGCCATTGTGGCCATTGAGAGCCAGTGCCAGTATATGATCGACGTCA
TCACCAAGTGCCAGCACGAGGGATATAAGACCATCCAGGTCGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62