GenePrediction:GLEAN_2796 Details

Name: GLEAN_2796
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3300032..3301507 (+ strand)
Length: 1476
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3300032..3300076 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_140:3300136..3300173 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_140:3300349..3300355 (+ strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_140:3300424..3300468 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_140:3300527..3300684 (+ strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_140:3300737..3300793 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_140:3300868..3301222 (+ strand)
Length: 355
Type: CDS
Source: GLEAN
Position: GCSC_140:3301277..3301507 (+ strand)
Length: 231
>GLEAN_2796 class=GenePrediction position=GCSC_140:3300032..3301507 (+ strand)
ATGGCTGAATACACTGTCGTACAGGGTCCGATGCAGGTAGACGACGTAAGTAATGGCAAGCCTTCCGCGAGGTCTCGTCG
CCGGCACTAAAACTTTATTTCTAGAATCGCGACGATGATCTAGGCTATGACGATGGTGCTTCGTAGGTCATGGATCTGAT
AGAGTCCTCTAGATGCCTGCTTTTTAACAATATTGTAGGGAGGCATCCGCCAGCCTTGTCTCGTCCCTGAGCTCAAGTAT
TTTAAATTACAGGCAAGCGCAACTTTCCCCCTAATTTTGCCGCTACGTGGCAAGATCGAACGCTAAATGTTTGTCAGATA
TGAGGTTCGTCCGAGACTAGTTTATCGTGTAAGACGTTTTATGTGACGCTAATATGAAGGCCCACGAGTCAGAATGGGCG
CCGCTACCATGCCTTTCGAGAGGGCGCCTATCTAGTAGTAAGTTACCAACATATGCCACTTCTTGGATCAGGCCATTTTT
GACACTGCGTGGTAGCCTAACGACGACGAAGAACAACAGCGAATGGACCTGGGCCACCACATCTACCGCCTGATTCTTAA
GGGCGATCTTTCACTTGCCCCTATTGGCGAGCACCGGCAGCACGTACTCGACTTAGGCACAGGGACCGGTATCTGGGCTT
TGGACTTTGCCGAGTTAGACACCTTACCATTTGGAGTTTGAAGTAACTGCTAACTACAAGGTTAGCCAATATCCCTCGGC
CGAAGTTTTAGGCACCGATTTAAGCCCAATTCAGCCTCAGTGGTACGTCGGCTCGGCTCTCAGCTAGAATCCATGTTGAT
AACTCTTCTTATAACACGTTACTTACCCGAAGATAGGACGGCCCCTAACTGCAGCTTCGAGGTGGACGACTTTGAGGAAG
AATGGACGTATCGTAGGAAGTTTGATTACATCCATGCTCGTGAAATCGAAGGCTGCGTTGGCGATCCCGACAAGCTCTTC
CAGCGCGCTTTCGAGAACTTGGCCCCCGGTGGCTACTTTGAGATCCAGACCGTCTGTGCAAAATTCGTCACCGACGACGG
CTCGGATAAGTTTGCAGGGAGCGCTATGCAGTGGGCCTCGCTTATTTCCGAGGCATTGACAAAATTCGGCAAGCCTTGGG
ATACGGCGTCCGAGTGGATGGATAAGATAAAGGCGGCTGGGTTTACCGACGTCCAGCAGGTTATCCGCAAGGTAAGCCGA
TTTTACTTTCCAAGACCGAAGATTTCCAACTCACCACTGCCATAGTGTCCAATTGGTGCCTGGCCAAAGGATCCAGCTCT
TAAGGAGATTGGAAAATTCCAGTTTGTCCAGCAGCAGCAGGCCGTCGACTCCTATACACCAGGTATCCTGTCTAAAGTCC
TAGGCTGGAAGGAGGACGAGATACAGGTTCTTATTGCCAAGGCGAAGAAAGACCTTCGAAACCCAAACGTACATCTATAC
ATCCCTGTCTACTTTATCTGGGGCAGGAAACCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62