GenePrediction:GLEAN_2798 Details

Name: GLEAN_2798
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3313963..3314359 (+ strand)
Length: 397
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3313963..3314095 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_140:3314172..3314359 (+ strand)
Length: 188
>GLEAN_2798 class=GenePrediction position=GCSC_140:3313963..3314359 (+ strand)
ATGATGTTCCAACAGACCGTTTTTGGCCTTGCTGCCGCTGCCCTGATGGCGCTGATCCATCCCACGGCTGCCTTCACCAC
TGCCTGCGAGTACCAGGAATACAAGTGTGGTCAAACTCTTTTTACTTCCGATGGTAAGATCTTCGTATACATCTGCTATT
TCTTCAATCCGCTCTTCTGAACCTTTCTTCGGTGTGCTGAATCTTCCAGGCTACAACATCACTGAATTTGAGACTGCCGT
TAATGCCACCGGCACGATTCCGCCCCTGGCTGACAGCCAGCTGCTCAACGTGCTCTATCGCTGCATCGACGTTGAGGGTG
GTCTGGTTGGCAACTCGTATTGCATTTCTGGCTGCATCACCATGGGCGATCTTGAGAACGATCAGTGCGCCATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62