GenePrediction:GLEAN_2799 Details

Name: GLEAN_2799
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3315038..3317593 (+ strand)
Length: 2556
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3315038..3315655 (+ strand)
Length: 618
Type: CDS
Source: GLEAN
Position: GCSC_140:3316186..3316302 (+ strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_140:3316385..3317593 (+ strand)
Length: 1209
>GLEAN_2799 class=GenePrediction position=GCSC_140:3315038..3317593 (+ strand)
ATGATTGAGGTCACAAAATATTGGCTCTCACCAACGGCACTCGTTCCAAACTCGCCATGGCCGTTGCTGCACTACAAAAA
TGTTCTGAACAAAGGGGACGACAGCGAGGCCTGCGTTCCGATTGAGGCCTGGGACAGATTCACCGGCAATGGATGGGAAG
TCCAGTGGCTGTACCGCTATGGTCAGACGCAGGACTCGCACTTTCATTCCGGGGTCCACGAGTGCATGGCCGTCCTCTCA
GGTACAGCAACGATACGATTCGGTGCCGGCGACAAGTCAGAGGACCTCGACGCGAACACGACGGGATCGGCCTTTGAAGC
CGGGGGAGTGGAAATCGAGGCCAATGCGGGCGACGTCTTTGTCATCCCAGCCGGCGTTGCTCACAAGACACACAACACCC
GGCCAGAGAGTGCGTTTCGACTGCTTTCGCCCGGATGCGGACGCGGCGTCGAAGCCGAGAACCCGAGACAAGCTCTGGTT
GGGCTGCCACTAACAGGCTTTACCATGATCGGTGCCTATCCACAAGGCAGCGAGTGGGATGCACTCCGAGGCGGTGGAGA
CTTTGAGGCGGTCTGGAGGGTTCCCAAGCCGGAGAGGGACCCCGTGTTCGGGGAGGCAGTGCAAGGACTGTGCAGTACCT
GGGCTCATCAAGACAAGTGAAATTGGTAGAGCCGTCTAAGCCCTCTCTGAGTAGCGAAACCTAGATTTCATTTCTCTGAT
CGCGGTTGAAGACTAAATGCAAGGCGATTTCGAATGGGATCCATCTGTATCCTGACGGTTGATGAAACTGGGTACTAACA
GACCAGCTACCATTTCTGTTGGGCAACTTTGCATGTCTTGGCGGTCCAGTTGGAATGGCCCAGTGTAAATAGACGTGTTA
TTGGCTTCAGCTCATCCCTGAACCCTGGGTGCACAAGATTTGGGGTTCAGCAAATAAGGATCATCCACCGTGTATCATCT
GACAGTTCGTATCACCGTTCCATTTACGCCATCTCCGTCTGACGGAAAGTAATAATCCATTTGAGCCTGTCTCGTTCGTG
AGTCTGTATATTCATCAACAGTTACCCTTTTTGCCTGTCTTGCTCACTATGAAGTTTCTCGGACAAGTCGGCGCTCTGCT
GAGTCTGGCCCACCTTTGTTGGGCACAGGAAGTGGAAGTGGATGTGGCTATTATTGGTGGAGGTGCCAGTGGCTCCTACG
CTGCCGTCCGTCTGCGGGAGGACTTCAACAAGACTGTCTTGGTGATCGAAAAGGCAGGCAAGCTTGTTAGTTGCTTGATC
CTGAGCCGTGCCTCTTCTTAGCTAACACAAGTTTGCTCACGAGGGGGGCCATGCAAACGCGTATCAGCCTGCCGCCGGGC
GGCCTATCGACTATGGTGTGGAGGCATATCTGAACCGCGAGACGACCATTGCGTTCTTCAAGCGCTTCAATGTCGGGCTG
ATCGACCCGACTCTGGCGAGCGACATTGAGCTCTTGCTCCTGACCAAGAATGTCGACTTTAGCACAGGACTTCCAGTAGA
TGTCAGCTACGGTCCTGTCGATCTCGTCGGAGTTCCCGTTGCCTTTCTGGAGTACACATCCTATGCCGTCAAATATCAGG
CCTGGTTTGCCAACGGCTACTTCCAGACGGGCGATGTGCCCGATGACCTCCTGCTCTCCTTTGGCGATTTCCTGGCAAAA
TACGATCTCGGCGGGTCCCTCGGGATTTTACGGAACCTCCTGTGGCTGTCGGATGCGCTGAACATGCCGACCTGGTTCGT
CATGTCGGTGGTGGGACTACCCCAGATCCAAGCCTTTGGCCTAGGCCTGATCGGACCATCTTTCAAGTGGCCCGCAACGT
ACTCGGCCGAGACGCTGTATGAGCGCGTTCTCGATCTACTGGGGGACGACGTGCTGCTCGGGAGCACGGTCGTGTCCAGC
CAGCGTTCCGACAGTGGTGTCGAGCTGACGGTGCAGACACCATCTGGACAGAAGACGGTCAAGGCGAAGAAGCTGCTCGT
CGCAGCGCCACCGTCACCCAACAACGTTGGTAGCTGGGATCTCGACGACAACGAGGCACTGCTCTTTGGCAAGTTCTCAT
GGGAAACCCTGTTTGTGGGCGTCGTCCAGGACACCGGCTTTCCTTCCCATGCGACCGGCATCCGCAACGCGCCAAACGAT
CCGTCTCGGTACTATCTTCCGCACGGCAGCTTTACCGATGCCTTTAGTAAGGCCGACACGGGCACCGGGGCAGACCTTTG
GACCACCCGCGTCCTTGGGGTTGCCGGCCTCAGCGCCAGCGAAGCCCAAACGATGATCTACCAATCTCTGACCCAGATGG
GCGAGGCGGGCACATACGACATTGCTTCACCCTCGCTCGTTGCCTTTACCGATCACGGTGCCAACGCGCCCAAGGTCTCT
GCGGCAGACCTCAAAGATGGCTTTTACAACAAGCTCTACGCGCTCCAAGGCCAGCGGAGCACATACTGGACAGGCTTTGC
CTGGGCACCTGATTACTCGTCGATACTATGGGATTTTACCGAGACGCTGTTTCCTGGAATCATCAGTGGCATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62