GenePrediction:GLEAN_279 Details

Name: GLEAN_279
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:748226..749124 (+ strand)
Length: 899
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:748226..748228 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_167:748331..748387 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_167:748505..748520 (+ strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_167:748587..748712 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_167:748802..749014 (+ strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_167:749090..749124 (+ strand)
Length: 35
>GLEAN_279 class=GenePrediction position=GCSC_167:748226..749124 (+ strand)
ATGGTTCGTCGCACCACAGCCCGACTCGATCGGCCCTCCTTTTTTGGCGTGCTCGTTTTGCGTCTGCTTCTTTCTCGCGC
AGCACCCTACTGACGCGCGACCCAGGCCGATTCACTTACCGAGGAGCAGGTCTCCGAGTTCAAGGAGGCCTTCTCTCTGT
TTGTACGTTTTTCCCCTGGCATTTGCCGTCTGCCCGGGGCCATCTGGTCCGGGCTCGGCCCCCTTTTTTCCTCTCGGCCG
GACGTTTTGCTAACCGGCCGCGCTTGCCGCGCTTGATAGGACAAGGATGGCGATGGTCCGTAGACCGTCCACCCTCTCCT
GTGGCGGGTGACGCGTTGTGCTGACACATTTTCCCGGACAGGCCAGATCACGACCAAGGAGCTCGGCACGGTCATGCGCT
CGCTCGGCCAGAACCCGTCCGAGTCCGAGCTGCAGGACATGATCAACGAGGTGGACGCCGACAACAACGGTACCATTGAC
TTTCCGGGTATGTCTCTAGACGGGCGCGCGGCGTTCTTCCGTCCCGTCTTTGTCTTGTCTTTTTTTCTGGCCTCGTGCTG
ACCGGGTGGTGGGCAGAGTTCCTCACGATGATGGCACGCAAGATGAAGGACACCGACTCGGAGGAGGAGATTCGCGAGGC
ATTTAAAGTCTTTGACCGCGACAACAACGGCTTCATCTCAGCGGCTGAGCTGCGCCACGTCATGACGACCATTGGCGAGA
AGCTGACGGACGAGGAGGTCGACGAGATGATCCGCGAGGCGGACCAGGACGGCGACGGCCGGATCGACTGTGAGTTTCCG
ACTTTCTTGCTGCTGCAGCAGCAGTGACAGTGACAGCGGACAGCAAGCTAACGGGCGGCTACAGACAACGAGTTTGTGCA
GCTCATGATGCAGAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62