GenePrediction:GLEAN_2800 Details

Name: GLEAN_2800
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3332135..3332833 (+ strand)
Length: 699
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3332135..3332273 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_140:3332325..3332375 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_140:3332487..3332833 (+ strand)
Length: 347
>GLEAN_2800 class=GenePrediction position=GCSC_140:3332135..3332833 (+ strand)
ATGCTCAAGTCACTTCTTTTCGGCCTCTTCGGCCTTGCCGCTGCAGCCGCTGCGGCCCCCCAGAGACGTGCGACTGGCTC
AACCATCTACGTCTATGGCACAGGCATCAAAGGCCTGCCCATGCAGGCAACCAGCAATGGTGAGCTTTCCTCCATCAGTC
CCAGACAGACCCTTTCATCTAACCGAGCAGGAACTGTCTTTGTTACCGATGATACTTCGCCCGGACTCTACAATGTCTCC
CGTAAGCTGAACTGACACCCCTGATTTTATTTCCTCGTCTGCCAATAATTTTCATATCCATGCACAAGCACATGCACAAT
ACTGATTCTTCCGCCTTCTCCTGTCCGACCAGTCAATGTTGCTGATAGCTCGACGCCGTGGACTTCCACCCTCGCCAACA
AGTCCGCGACCTTGTCGGGCTATTCGTTTTACATCATTCCTGCTGAAAACTCCTTCGCCGCCATCGGCTTCGTTCGGCCC
GATGCAACTGCTCCTACCGGTGCCGTGACGACCGGTTTCGCGCTCCTTGGCACTAACATCCAATACGCCGATGGCGACAC
TTACATCTCTCAGTTCTGGGCGCGGCCGTCCAACTCGACTGCGTGGGAGATTCTCTGGAACTCCAGCGGTGACAGCCATA
GTGACAGCATCCCTGTGACCCTCAAGCTCACAGCACCCACTGTTGTGGAGCGTGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62