GenePrediction:GLEAN_2801 Details

Name: GLEAN_2801
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3334830..3335782 (+ strand)
Length: 953
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3334830..3335160 (+ strand)
Length: 331
Type: CDS
Source: GLEAN
Position: GCSC_140:3335214..3335782 (+ strand)
Length: 569
>GLEAN_2801 class=GenePrediction position=GCSC_140:3334830..3335782 (+ strand)
ATGGCAAACTTCTCTTCGCCGTCCACTCCCGGCCCCGGCGGCTTCATTCCTGACCTAGGACTCCTCTCGCCGTCACCAAG
CCAAGCTTCGTCTGTCCGCAGTCACACTCCAGGCCTACCGCACCCCCGTCGGAATCCCTTGCGTCCTGGGTCTTCCAAAG
AGGACCTGGTCCGGCGCTATGTTGAGAGCCGACTGCTGTATATCAGCCGGCGCTTCGTCAAGAAGTACGGCATCGCAGAA
CCCGACGATGAGGTGGTTGGCTACAAGTCCATGACAGAGCTTGGCCGCGATGTGGACGACCTCTTGAATGTTATTTGGCT
GTCGGGAACACGTCGGTTTATCTCTGTCCTCTTTTCTGATTAACCGAGCTGACGCCTCTCGCAGCGAGCCTCCAGGCACC
CTACCTGCTGAATATCGCAGGCGAGCTGGTCTCCTGGGTAGGCGGCTTCCAGCCTGCGCCCAGGGTCACATTTTCAGTTC
TGCAGAAGCTTGATCACTGTTTCGCTAGCCTGCTAAGTGGTGCAGATGTCGAGACGGGCGAACCTCTCCCCGGCTTTGAA
AGAGGATTGCACGTCGGCATGACTCGTACCGACATGGTGCGATGTAGGAGCACGGCCGAACTGACACGTGTCGTGGTGGC
CGATGTAATAAGTCGAGCATCACCGGACCCGGCAGACGAAGCAGAGAGCCGACGTCCAGCAATGAACACGAGGGTAGATC
CCGTCAACAACGACGACGATTATGAGCAACGGCAGACGGGGGACGAAGAAGGAGCACCAGACTTCCAGAACGACGAAGAT
GAAGATCTTCATATGGACGTTGCCAAGGTTTACGAAATGACGCTGGTCAAACTGGGCGAGGTGCTTGGTGATGGGGGAGG
ACGAATTGGTGAGATATTGGCCAAGGACGACGTCGACATTGACGATGCCGACGATGCCGACGATGACATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62