GenePrediction:GLEAN_2802 Details

Name: GLEAN_2802
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3340250..3341180 (+ strand)
Length: 931
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3340250..3340585 (+ strand)
Length: 336
Type: CDS
Source: GLEAN
Position: GCSC_140:3340688..3341037 (+ strand)
Length: 350
Type: CDS
Source: GLEAN
Position: GCSC_140:3341102..3341180 (+ strand)
Length: 79
>GLEAN_2802 class=GenePrediction position=GCSC_140:3340250..3341180 (+ strand)
ATGTTCTCATCCGCTCTCATCGTCTCTCTCCTGCCGGCCCTGACCGCCGCGTTCTCGCTGCCGTCGTACAACGGTCTTTC
GACCGTGTGGCACGACGACTTCTGGGGCAACGCGGGCGACTCGCCCAACGTCACCCACTGGAACGTCATCACCGGCGACC
TGGGCCTGAACAACGAGCTGGAGACGTACACAGAATCCAACGAAAACTTGCAGATCAGCGGCGGTGGCACGCTGCAGCTG
ATCCCACGGCGCAACAGCTCGACCTCGTCGGGCTGGACATCGGCGCGCATCGAGTCGGTCGACTCCTACACGCCGGTGCC
GGGCAAGAACACCCGCGTTGAGGCCAGCATCCGCATGGGCACCGGCAGCAACAGAACCAGCAACAGCACCAGCAGCACCA
TGCAGGGTATCTGGCCCGCCTTCTGGATGCTCGGCCAGTCTATGCGCGAGGGCACCAGCTGGCCGCTCTGCGGCGAGCTC
GACATCCTCGAGCAGGTCAACGGCAAGCTCACCGGCTACGGCACCGCCCACTGCGAGAACCACTGCGAGGAGCCAACCGG
TCGCCAGGGCTACACATCCATCCCGTCCGGCAGCAACTTCCACACCTGGCGCCTCGACTGGGACCGCACCTCCAACAACT
GGCAGACCGAGTCCATCACCTGGTCGCTCGACGGCGTCGACTTCTTCTCCATCAACGGCACTACCATCGGCGACCAGGCC
ACCTGGAGCACCCTGGCCCACAGCCCGTTCTACATTCTGCTGAACGTTGCTGTCGGTGGCACGATGGCGTATGTTCTTCC
TTTTTTCTCATTACTTATACTCTGTGCAGCCGGCTAACAGTATTCTTTCTAGTGGCAACCCTGACTCCAACACCCTGGAC
GGTTACGACAGTATGATGGAAGTCGCATACGTCGCCGTCTACTCGAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62