GenePrediction:GLEAN_2803 Details

Name: GLEAN_2803
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3352510..3353329 (+ strand)
Length: 820
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3352510..3352544 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_140:3352719..3352941 (+ strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_140:3353018..3353329 (+ strand)
Length: 312
>GLEAN_2803 class=GenePrediction position=GCSC_140:3352510..3353329 (+ strand)
ATGTCCGCTTCCAAAGCTGCCCGTTTGGGCGAAGAGTACGCACTCAATCTCTATCCTCTCTCCCCCCTCACTGCCGTTTG
ATAGCACGTCCTTTGATTGCATAGGGAAGCTGACCGAGTCACAGAATATGGAAGTATGCAGACGCTCCGCCACAGCTCCA
CCGCTCAATCCGTTCGCCTCCCCTCCTAACCTCTCTCGAACCTACCTAGAACCCGGATAGACAAGGTTAATGCCGAGCTG
GTCACCCTGACGTACGGCACCATCGTTGCACAGCTGTGCAAAGACTTTGATGGGGACTACGTCGAGGTAAACAAGCAGCT
CGACAAGATGGGATACAACATCGGCCTTCGCTTAATAGAGGATTACCTTGCCAAGTCTATCACCATGAAGAGGTGTTCCA
ATTTTCGCGAAACTGCCGATATGATTTCCAAGGTGTCTTTTGCCCCTACAATCACCTCATTTTGTCCATGTTCCTACTGC
CTACATACTCTCTCGCTAACACCTCAAGGTTGGCTTCAAAATATTTCTCAACGTGACTCCCACCGTCACCAACTGGACCA
GCGACGGCAAACAATTCTCTCTTGTCTTCGATGAAAACCCACTGGCAGACTTTGTCGAGCTGCCGGACGATGGCCGTGCC
CAGGACGAGCTGTGGTTTTCCAACATTCTATGTGGTGTCTTGCGAGGCGCACTTGAGATGGTACAAGTGCAGGTAGAGGC
ACACTTTATCAGCGATGTGCTCCGGGGCAACGACACGACTGAGATGAGGATATCGCTGATCCGGTACATCGATGACGAAC
TTCCACAAGAAGATGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62