GenePrediction:GLEAN_2804 Details

Name: GLEAN_2804
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3356476..3359651 (+ strand)
Length: 3176
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3356476..3356536 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_140:3357035..3357276 (+ strand)
Length: 242
Type: CDS
Source: GLEAN
Position: GCSC_140:3357357..3357520 (+ strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_140:3357589..3359056 (+ strand)
Length: 1468
Type: CDS
Source: GLEAN
Position: GCSC_140:3359128..3359424 (+ strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_140:3359490..3359651 (+ strand)
Length: 162
>GLEAN_2804 class=GenePrediction position=GCSC_140:3356476..3359651 (+ strand)
ATGAACAACGTCAACATGGCCAACATGAACGCCATGGGTGGTGCTGTCGGCGTCCCGATGAGTATGATGAACAACGTTGG
AGCGCCTCCTGGGTCTGTGGGCCGTGCACCCCAGCAGCAGCAGCAGCAGCTTCAGCAGCAGCAGCTCCAGCAACAGCAAA
TGCAACAACAGCACATCCAGCAGCAGCAACTCCAGCAGCAGCAACAACAGCAGCTTCAGCAACAACAGCAGCAACATCAG
CAGCAACATCAGCAGCAACATCAGCAGCAGCAGCAACAACAGCAACAGCAGCAACAACACCAGCAGCAGCAGCAGCAACA
ACAGCAACAGCAACAGCAACAGCAGCAGCAGCAGCAACAGCAACAGCAACAGCAACAGCAACAGCAGCAGCAGCAGCAAC
AGCAACAACACCAGCAGCAGCAGCAGCTTCCCATGAATGACATCAACAACCGTGTCATCTTGAATACGTACATTTACGAA
TACTTTATTCGCTATGAGATGTTCGACTGCGCAAGAGCCATTCTGACACACCCGAACAATATTCAAAAGCCTGGTCCAGG
GTCTCGAAGGGACGAAAACGGAATCGTTGTTGGCAACGGCATCAACGACGATGCTATGGACACGGATACGAAGGACGGCA
TCGAGTCCAAGCGTCCCGAGGACCTCCCGGCACCAATCACGGTGATGCCATCTGACAGTTGCTTTCTGTATGACTGGTTC
TGCCTTTTCTGGGAAATGTTCAATGCCCAGAAGGGCAAGGCTTCGCATCCTGGTATTGGACAGTACATTCAGCACATTCA
GGTTTGTTGTCCCTCCACTTTCTTGGGCGTTCTTCATATCCTGGGCGTAGTTCTTTAGCTAACCGGGCGTCTTGTGTGCA
GGCACAATCACGTCTTCGACAAGCGCATCAACAGGACATGCTTCGCCAGATTCGCCCCGAATTTCAGCAGCAGTATATGA
TGCGGAGCATGCAAAATGGGGCGATGCTTGGCATGAAACCAGGGAACAACCTTCCGCGTACGGCTATGGCCAACAGCCAG
AACATGTGGGTTTTCCGAGCGTGCCTGGACTGACTACGAATTCATGTATTGACTCTACTATTTCACAATAAAGACCGCAA
GCGATGAACATGCTCCAGGCGAAGCAGGTCCAGATGCAGCAAAACCCATCAGACATGGATGGCAACCGGCCGCGGCCTTC
GTCTCCTGGTTCCGCCGAAAATGCACCCTCCCCGTCAAAGAGACCCCGCATTGACGTGCCCTTCAATCCTAACCAAGCTG
CTCTGATGCACAATGGTAGAGTTGCTCAAGGCATGCCTGGCCAACAGGTAGGATCTGGTCCTATGACTCTTCAGTTGCAG
AACATGCTCCTCGCAAACGGCATCAACCCAGCTTCTTTAAACGCCGAGCAGTTGCAGGCTTTCCCCAACCAGTCCCCGGC
CTCCCAAGCTAAGACAATCCAGGCATACTCACAAAACTTGCAACAGCACCACAACGCTCAGCTGCCCAATAAACCAATGC
CCCCAAACGTGACCGGTCCGCAGGGCCAAGGCTCTCCCATGGCCCCGCCAGGTCCGGATGGTGCCACAATCAACGCTTAT
TACAATGCTGGTGAAATGGGAGGCCAAGGCATGCGCGCTGGACCCGGTGCTGCCCAGGCCGGTGGCGGCAGCAACCATGC
TCTTCAGGACTACCAGATGCAGCTCATGCTTCTCGAGCAGCAGAACAAGAAGCGGCTCATGATGGCGCGACAGGAGCAAG
ACGTTATGGGCGGGATGGGTCGTGGAGACGGCACGCCTGGCGCGGCGGGTGTGCCGGGCGTGCAGGTGCCTCCGGGCGCC
CAAGGGCCACCAGGAGCTCCCGGGGTGCCTGTGGTGGCCGGGGGCCCTGGCGTGCCGGGAGTCCTCGGAGGGCCGGGGGC
GCCAAATGCTAGCCAGCCATTCCAGGGTGCTTCGCCTCAGGGTGGGCGGCCAGGCGCATCACCCAACCCTGTTGATCAGA
TAAAGCGCAGCAACCAGCAGATGGCCAATGCCGGCATGGGCTCACCTCTGCCCGACAACCCACAGTCTCGTGGCTCTCCC
AACAGCGTCAACTTTATGGCAGCACACATGGAGCAGACAATGGCACCTGGCTACAGCATCGTCGGACCGCAGATGAACGG
AATGCGGACACCGGGATCCCACCCTGGGATGCAGTTCAACGGCCAGATGAACACACAGTTGATGGCGCGCCAGCAACAGC
AACAACAGCAGCAGCAGCAACAGCAGCAACAACAACAGCAACAACAACAGGCGGCTGTGGCTGCAGGCCAAGGCACACCG
CAGATGCAGTGGCAACAGCAGCCCGGGGCACCGAATGGTGGCCAGATGGGCGGTCCACAAGGGCCACAAGCCCAGCAGGT
GCAGGGCACGCCGCAACAACGGTCCATGCCACCACCGTCGGGACCGGTTGCTAACGCTGTTGGCAACACGAACCAGCGAA
CGCAGACAGCATCGCCGCAGACGGGCACAGCTGCACCACCGACGCCACAGCAGTCCTCCAAGGCCAACCCGAAAAAGAAG
GACGGCAAGGGTGCCAAAAAGGTACGACCTTACAACGTGACTCCCCTTGGCGTATTGATGCGCCTCGATTTAATAGCTGA
GCTGATAAATAGAAATCTCAGACGGCCGCACAAAAGAAGTCTGGCACGAACCTCAATGCTGCAGCTACTCCGGTGGCTGA
AGCGTCGGTGGAACCTGAGCCTCCCACCCCTGCCACTCCGATCACGCCGGCCAACCCGACACTTTCGTTTAATGGAAAGG
TACCTGGTCCGAACGTGACGGTGCCCGCTGGCCAGGCCGTGGCGAATGGACAGGCGGTCCCTCCAGCTGCATCTGCGGCA
GTAGCACCACCGCAGCAGATCCACGCTGATCCGAACCAAAACGCGTTCACTGTGGAAAACACGCCAATGGTACGAGACCG
TGCCACTGCTGCCATCATGATTGTGCTCCGTTGTTTGCTAACACCACTAAGCAGGGCTTTGGGCTTGAGTTTGCTGACCC
GCTCACGACTACGGACGTGCTAAACGACTTTGACTTCGACACCTTCCTCCACGACAGTGCGGATGACCCGAACAGTTTCG
ACTTTGGCTCTGCAACGTTCGGGCTGGAAAACCCCGGCGAAATTGGAGCCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62