GenePrediction:GLEAN_2805 Details

Name: GLEAN_2805
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3360854..3362109 (+ strand)
Length: 1256
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3360854..3361172 (+ strand)
Length: 319
Type: CDS
Source: GLEAN
Position: GCSC_140:3361229..3362109 (+ strand)
Length: 881
>GLEAN_2805 class=GenePrediction position=GCSC_140:3360854..3362109 (+ strand)
ATGTGGCCACGGCCACAGCCACAAGCGCAGTCTCTCGGACGAGACGGGGCCCCTTGGCGGTCCTGGAGCGGTTATGCTCG
CCTCCCATGGACTTCTGCGGCCGGCGTCGTGCTCCTACACATCCTTGCAATCTGTATTTTGCTGGTCGCCGTGGACGCTG
GCTGTCTGACGGCATGTGACGATAGTGTATCGGCCGTCCTTGCAGACACGAGGGCCGATATTCCATCGACTGCCGAGTCC
AGCGCAGACTGGGGCAGAGCTGACGTGGACAAGGCGAATGCAAGCTGCCCGACAGCTGGCTGCATTGCCTCCGTAACAGG
TGTGTGTCCGAACTGGATTTGGTGAGACCCAAACGGTTGATCTGACTGTAGACAGGCGACATCACCCTATCGGGACCGCC
CATGACGGGTGATTTGCAAGCACTGCTGTCAACCTCGACCGGGTCTGTGGCCGTTTCGAGCAACGCGAGCTCTGTCTCGT
CCGCAGCCACAACGAGCACGACACCCAGCGAGGCGACCAGTGTCGAAGTCGTCTCGCCGCCGTCCTCCATGTCGACGTCT
CTGTCGCAGTCTCTGCCAGCCCTGTCCCAGCCACCTGGCACTCCAGGTCCATCCTTGCCGCCGTCAGCCACGCCGACGGG
CGATGCCACCACGCACAAACCTGTCGCGACCATTCCGCTGGCTGTGGGTGTCAGCGTGGGCGGCGTGTCTCTCGCGCTGG
TCGGTATTGCAGCGGTGCTGCTCTGGCGACGCCGACGGAAGCGCAGCGGTAGCGACGACGATGACGTTGACGAAAATGAC
AACGGTGGCGGCGGCAGCGGCAGTCTCCCCCGCGCCGAGTCTCCCCCTCCACGAGATACGCCGGACGGCCTCCACCCCTC
GGCGTCCGGGCTGCTCTTTCGCGGTGGCAGCCTGCAGAGCCGGCGGCCGAGTGGTGGCGACACGAGTCAAGACGGCGGCG
ATGACGGAAACGAAGGCGCCGCAGTGGCGGCAGTGACCCGTCACTATCGCACCAGCAGCCTCCGGCAGGGAAGCATTCTC
AACGGTCTCTACGCCAGCAGCCGGTTCACGCCCGATGCGGTGGCCATGCACGACGTTCCGCGGGTGCCATCGGTAGGACC
AGAACGGCAGTGGCGTGGCCCGTCGCCGACGTCGCCAACGAAGCCGCCCGAGATCCCCTACGACGGACGACGCTTCCCAC
CATACTACGGCATCCCCGGCATGGAGCTGGACGGGTATGCCGAACTTCCTGGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62