GenePrediction:GLEAN_2806 Details

Name: GLEAN_2806
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3367306..3375989 (+ strand)
Length: 8684
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3367306..3367846 (+ strand)
Length: 541
Type: CDS
Source: GLEAN
Position: GCSC_140:3367918..3370007 (+ strand)
Length: 2090
Type: CDS
Source: GLEAN
Position: GCSC_140:3370077..3375353 (+ strand)
Length: 5277
Type: CDS
Source: GLEAN
Position: GCSC_140:3375432..3375989 (+ strand)
Length: 558
>GLEAN_2806 class=GenePrediction position=GCSC_140:3367306..3375989 (+ strand)
ATGTCATTGAGCAATGACTGCTATAAGCTACAACGTTTTTACAGCGCTCTTTCCTCTTTCTGGCAGGAGTTCCCCGCGAT
CGCTAACACACTCTTGACCGCCTTCCAAGTTGGGCAGGCCCCCCCACCTTCCCTCTGGTGGTGGGATCTGAGCCCTAGCT
GCCTTGTCCCGGACTTTACGAGAACTGTGAGATGGACAAAAACGGACGTCTACTTTGCGATTTCTGAGTCAGGCAAAAAA
ATTCTCGCCAGATCTCGCAGACCCGCACGACGACCACGACCTGCATCTCGCGGAGCAGGACACTTTCACCCGGGTGGAAC
TTCTGGCCAGACGGACCTGTTGGAGCTGGTAGCTGCTGGAAGCCATGCCAGCAGCGCAGCCACAGTGCAGCTGAACATGA
CTGACTCTACAACCACGGTCACCAACGGCGCCGTTGCCGTCGGCCTCGACCCTCTCTCGACGCGCGTGGCCCTGTTGACC
TCGTCCAAGACTTCGCGCATTGCCCAGCTGCGGACCATCGACGACAAGATTGTCCACGGAAGTAGGTTCTGCCGCCAGCT
GTGCCCGAACTGAACGTGAAATCCGGGGCTGACTGTCGCTTTCTCTCCTTAGATATCGATCCGACCGGCATTGCCAAGCT
TCTGCCCATTCTCTTCTGGACCCATGGCTCTTACGAGGACCGCGCCTCGCGACGGGCTGTTCAGCGCTGCCTGGCCTCCA
TCTGCGACAAGAAGGACGCTGCCCTGCTGACGCCTCTGGTGGCTGCCATCCGTGCAGATGCCCTCAAGACAAACACCGCT
GTCGGTGGCACCTTTGTGCTCACCGAATGGTGCAGTCTCCTGATGCAGCACCTGGCCGGTACTTCCCTATGGGACTCTTT
CAGCAAGGACATCCTCCAGAGCCAGGCCGGCGCCCTGGAAAAGTGCACCCGCTCATCGGTCCGGCCAAGCGTCGCCCATT
CGGCTCTTGTTATAGCCCGCCGCGGATTCAGGAAGCTCATCGCCCTTGACGGCACCCGCGAACAGAACATCAAGGAGGCT
GTTCAGCTGCTGGCCGCCAAGGGCCCCCACCCAACCGCTTTGAAAGCAGTCTTCCTCGGCGTCATCGCCGGCGTCAGCTC
TCGCAACGCCAAGGCTAAGCCCATCTTCGCCGGCCTCAAGTCGCAATACTTTGAATTCTACACCCGTGAGATCACCGGGT
CCAAGGTGCCCCTGGCCAGCAACGTCGCCGACGGCCTGCACGACTTCTTCGCCGCCTTTGTTGCGGCCGAGGACCTCCAG
ACCGTTGTCGTGCCCGCTTTGAAAAAGGGCCTCCTGCGTGCGCCGGAGATTCTGCTCGACGACCTTATCACGCCTCTGGT
GAAGGCGCTGCCCCAGAGCTACGATCTCTCCAAGATCCTGGACGAACAGTTATCCAAGCCGCTGCTCTCCAACGTCAAGT
CAAGCAAGGAATCCGTGCGCAACGGGTCCCTGACAGCCTTCCGGGCCATTTCTACCCGGTGCACAAACTTGATCGCAGTG
GGTCACGTGGTGGATGAGGCCCTCGTCCCTCTCCAGACCGGCAAGCTGTCGTCGCCGGAGCACAGAGCTCTGCATTCCCA
GATTCTCGAGGTCTTGCCCAAGTCGGACGCCACGACGGCCAAGGTGGCCGTTGGCATTGCCACGGCAGCATCCAAGGAGG
GAAACGAGGCTGCCTTGGTGGCGGAGACGTCTAGCCTGACGCAGAGCACTATCACGCTTTTGAAAGGCACGGCTGACCTG
GCAAAAACCGTGATCGACGCCTATGTGAAGGGCATGTCCGACAAAAAGCCACCAGTCCGTCGCATCTGGATCATGGCTGC
CGGAGAGGCTCTGTACACATTTCACACTTGGCAGGATTCTCTGCCGGCCAATGCTAGCAAGTTTGCCGAAGCCGTCTTAC
CACCACTGCTCGAAATTTACACAGAGGTGCTCACCAATCCCGCAACGGCTTCCCAGAGCGGACTCGTCATCGGCGGCTTT
GTGACCTGCGGCATTGCTTCACTTCTCGAAAGCCCGTCGACGCCAGCACTAACGGCCTTGTCGAAGAAATTTTCCGTCAA
AAAGCAATGTCTGACACTTGGACCCAAACCATCGTTTCTCCTGAGTCCCAGGATATACACCAAACTGACTTCTGATGGCG
ACATCCAGTGGTTGTACCGAGCGCTTCTGGCTGTGTTCGTCGCTTTAGAAGAAAACAAAGAGTCTGCCACAAATGTAGCG
TGGGCAGAAGCATACATCTACGCGGCCACTTCTACAAACGGCGGCCCACTTCTGCGCAAAGAGGCCACCAGCGCACTCAC
CGACCTCTACTTCCGCCACCAAGCTCGCGTTTCCGAGATTGCCATCGCTGGAGCGTGGCATTGGCTCGAAGCCCTGGACG
CAAACGACAAAGAGAGTGCTCCTGTTCTTTCCAAGGCGCAGAATGAGCAGCTGCTTCCGTTTATCAGCGCCATATGTCGC
AAATCAAAGGACTTTGTCAGAGTTGTCGGCAAGGAGCCGGAAAAGAGCCAGCTCGAGCTGCAAATGTGCTCCCTTGTCGT
CCTGGCTCGCTCGGTTTTGATTCCTTCGTGTAGCTGGATCGAGCTCTGTCTGCGTGTCGAGGTGGACCCAGGCAGCCTGG
CAGAGCATCACGAGGAGCTACTTCTCCAAGAGATTGCGGCAAGAACGGTCTTGACGCAAAAGGTGAGCTAAGCACAAATT
TGCGATTCCCGAATTCGTCTCCGCAGTTGCTAACCCTGCCTGATTTGACAGTCTGAGCCAATTAAGTCGGCAGCTTACGA
GGCTGCGGCCGAACTGGTCTTTGTTGCTCCGGACAAGATGGCACCTCGCATTGTCGAGCTGATTCGCCAAGACTTGGATG
CCAAGGACCTGCACTCCATCGGTCCAGTCGAAGCTGCCATTTTCCGGGCGCCCGAGGGAACGACCTTTATCGATGTCCTG
GCCAAGAAGCAGAGCAGCCTCCCGAGCAAGAACAGCAAGGACTACGACGTGCTCAAGTGGGAGGAAGAGCTCCGCACCCA
GCTTGCCCAGAAGAAGGGCCAGCAGAAGAAGCTGACAGCCGAGGAGACGGCAAAGGTTAACGCGCAGCTGAAGAAGGAAG
CGGAGATTCGCAGACAGGTCAGCCTGCTCGAGGCACGTCTCCTCCGCGGCCTTGGCGTTATCCGGAGCCTTGCCCAAGGC
CCACCGACTGATGCGACGTTGTGGATGGGTCCGTCGGTCCGGGCGCTCATGGCGGCCATCGAAGCAGGTGCTTGTCTGAT
CACGGGCGACGTGGCCCCCCTGGCCTTTATTGCCCTGGCGGAACGAGTATCTTCACGGCTGGGTTCGCTGCGTACTTTTA
TCGGAGTGGCGACTCTGCGCGCCCACGGCATCACATCTCTGCCGGATGTCCTGCAGGAAGAGCCGCTTCCGGACCTCGTT
ACGCGAGTACTGTACCGACTTCGTGGCGCGGGAGAGCAGCGGCCGTTTGACGCGGTCTCCCTGATCTACATGGTCCCCCT
GCTGCTTCTGATTCTTCAGAACGGCGGATTTTCCGAGGCTGCCGATGAGCGTGACACCCAGCTAGTTCTGTCTGTCGAGA
TCCTCTCTTTCCACACTGATGTCTGCTCGGACGAGGCTGTCCCCCGTGCCGAACTGCTGGCCATCCTGACCTCGGCCATG
CAAAAGTACAGCCAACACTACAAGATCATCAAGGACTGCTTTTCGGACCTGGTTCGGTGTGTTGCTCCCAACATCAGCGA
AGAGGAGGTTGGTGTTCTGGTACAAGGAGCGATTGTGCCACAGGGCACTGTCCGGTCAACGGTGCTTCAGTCGGTTAATG
CCGAGGTGGACATGAGCGATCTCCCACCGTCAGAAGAAATCTGGCTAGCCTGCCACGACGACATTGAGGAGAACGTCGAT
CTCGGTCGTGAGATCTGGGAGGAGAGCGGATTCAAGGTGACGGAAGAGCTGCCGGTCAAAACACTGCCTTACCTGGAAAG
CAAAGATAGCCAGCTGCGACGGGCGGCAGCACGGTCTCTGGCCGAGGCCATCTCGGTGCTCCACTCACCAAGAACGTTTG
ACAGCATTGCCGAAAAGTTGCGGGCTTCGTACATTGAGTCTGCCAAGCCGCGGGTGGCTCAGCTGGACGAGTTCGGCATG
CCGAGGAAGATGGATCTGTCCGACCCTTGGGAAGCACGACATGGTATTGCGACGGCCTTCAAAGAGCTTGCTCCCAACCT
GGACAATGAGCAGGTAGAGCCTTTCCTGCACTTTTTGATCGAGCAAGGTCCTCTCGGCGACCAAAACGGTACGGTTCGGG
GGGAGATGCTGGATGCAGCGATCAAGGCGATCGAGGTGCACGGAAAGCCGATCCTGGCCAAGCTGATGCAGACGTTTGAG
ACGACGCTTGCGGCACCAGACAAGAACTCGGAAGCGGCAGACCGGGTGAACGAGGCGGTGATCATCATGTACGGCGCCCT
TGCTCGGCATCTGAAGCCCGGGGATGCCAAGATTCCGGTGGTGATCGAGAGACTGCTGGCGACGTTGAGCACGCCGTCCG
AGACGGTTCAGTACGCCATTGCCGAGTGTCTTCCTCCGCTGGTGCGGACGTGTGGCGACAAGTCGTCCAAGTACTTCAAC
CAGATCACGGAGACGCTGATGACGGCGAAAAACTATGCGGTGCAGCGAGGTGCGGCATACGGCCTCGCGGGCCTGACGCA
GGGCCGTGGCATCGCAGTCCTGAAAGAGTACCGGATTCTGACGACACTGCGGACGGCGATGGAAAACAAAAAAGAGGCGA
ACCAGCGAGAATCAGCACTGCTGGCATACGAGCTGCTCTCGACCATTCTGGGGCGGCTGTTTGAGCCATACGTGATCCAG
ATCGTGCCACAGCTGCTGGTGGGATTTGGCGACGGCAATCTCAACGTGCGAGACGCGTCTCTGGCAGCGGCCAAGGCGTG
TTTCGCCAGGCTCAGCTCGTTTGGCGTCAAGAAGATTCTGCCGACACTCCTAGACGGCCTGGACGACCCGCAGTGGCGAA
GCAAGAAGGGCGCGTGTGACCTGCTGGGCGCGATGGCGTACCTAGACCCGCAGCAGTTGGCTGAGAGCCTGCCAGATATC
ATCCCGCCGCTGACAGCAGTGCTGAACGACAGCCACAAGGAGGTGCGGGCGGCGGCAAACAAGAGCTTGAAGCGATTCGG
AGAGGTGATTAGTAATCCGGAAGTACGGAGTCTCGTGGACATTTTGCTCAAGGCGCTCAGCGACGCGACCAAATACACGG
ACGACGCACTCGACGCGCTGATCAAGGTGCAGTTTGTGCACTACCTGGACGCGCCGTCGCTGGCGCTGATCAGCCGGATT
CTGCAGCGCGGCCTGGGCGACCGGTCGAACACGAAGCGGAAGGCAGCGCAGGTAATTGGCAGCCTGGCCCATCTGACGGA
GAAGAAGGACCTAGTGGCCCACCTGCCAGTTCTCGTGGCCGGACTCAAAATAGCGGTGGTGGACCCGGTGCCGACAACAC
GGGCAACGGCCTCGCGGGCTCTCGGGTCGCTGGTGGAGAAGCTGGGCGAGGATGCGCTGCCAGATTTGATCCCCGGGCTG
ATGCAGACGCTGAAGTCGGACACGGGCGCAGGCGACCGACTAGGATCGGCACAGGCGCTCAGCGAGGTGCTCGCAGGACT
GGGCACGACGCGGCTGGAGGAGACGCTGCCGACAATCCTGCAGAACGTCGAGTCGTCGAAACCGTCGGTACGGGAGGGCT
TCATGTCGCTATTCATCTTCCTGCCGGTGTGTTTTGGAAACAGCTTCTCGGCCTACCTGGGCAAGATCATCCCACCGATC
CTGGCCGGTCTGGCAGACGACGTGGACTCGATCCGCGAGACGGCACTACGGGCAGGCCGACTGCTGGTGCGCAACTTTGC
GTCGCGGGCGGTGGACCTGCTGCTGCCGGAGCTGGAGCGCGGGCTGGCAGACAACAGCTGGCGGATTCGGCTCAGCTCGG
TGGAGCTGGTGGGCGACCTGCTGTTCAACCTGTCGGGCATCACGGCCAAGCAGGACGGGGACGAGGACGAGGAAGTGGAA
GAGGAGGCGGCACGCGAGGCGGGATCGACGCTGCGCGAGGTGCTCGGAGTGGAAAAGCGCGACAAGATCCTGTCGGCGCT
GTATGTGTGTCGCTGCGACACGGCGGTGGCAGTGCGGACGGCAGCGATGGGAGTATGGAAGGCATTGGTGCCGAGTCCGA
GGATCCTGAAGGAACTAGTGCCGACGCTGACTCAGCTGATAATTCGCCGTCTCGGCAGCGCCAACATGGAGCACAAGGTG
ATTGCGAGCAACGCGCTGGGCGAGCTGATCCGTCGGGCGGGCGACAACATCCTATTGACGCTGCTGCCGACACTGGCAGA
GGGATTGCGGACGTCGTCGGCGGACTCGGACGCGAAGCAGGGCATCTGCATTGCGCTCAAGGAACTGATCTCGTCGGCGA
ACGAGGATGCGCTGGAAGAGCACGAGGCGATGCTGCTGGCAATTGTGCAGTCAGCACTAACAGACGCCGACGACGAGGTG
CGCGAAGCAGCAGCCGAGGCATTCGATTCGCTGCAGCAGATCATGGGCAAGCGGGCTGTCGATCAGGTGCTGCCGAGTCT
GCTGCGGCTGCTGCAGGACGACGGCGAGACGGCACAGAACGCTCTCTCGGCACTGCTGACGCTGCTGACGGACAGCACGC
GGAGCAACATGATTCTGCCAAACCTGATCCCGACACTGATCCGGCCGCCAATCTCGGCTTTCAACGCCAAGGCGCTGGCA
TCGCTGTCAACTGTCGCCGGAGCCGCGATGAACCGACGGCTGCCACACATTCTGAACTCGCTGATGGACAACGTGATCGA
GACAACGGACGAGCAGCTGCGGGCCGACCTGGAGACGTCGTTCGACACGGTCGTGCAGTCGATGGACGAGCACGACGGAC
TCAACACGGTGATGAACGTGCTGCTGCAACTGCTGCGTCACGAAGACCACCACAAGCGCGAGGCCGTGGCCCGGCGACTG
GCCGTGTTCTTCGCGAAGGCCCACGTGGACTACTCGCGCTACAACCAAGACCTGATCCGGGCGCTGCTCATCTCGTTCGA
CGACCGAGACCAAGACGTGGTCCGGTCAGCTTGGGGTGCGCTATCGGAGCTGACTAAGCGACTAAAGAAGGAAGAGATGG
AAGCACTGGTCGGGTCGACACGACAGACGCTGCAGCAAGTGGGCGTGGCAGGCGTCAATCTGGCGGGTTTCGAGCTGCCC
AAGGGCATCAACGCGGTGCTGCCGATCTTCTTGCAGGGGCTAATGAACGGGACGGCGGAGCAGCGGACGACGGCAGCACT
GGCGATTGCAGACGTGGTGGACCGGACGAGCGAAGCGTCGCTGCGGCCGTTTGTGACGCAGATGACAGGACCGCTGATCC
GGGTGGTGACGGAGCGGTCGACGGAGGTCAAGTGTGCGATCCTGCTGACGCTCAACAATCTGCTGGCCAAGATGCCGGCG
GCGCTGAAGCCATTTTTGCCGCAGCTGCAGCGGACGTTTACCAAGTCGCTGGCCGATCCGACGAGCGAGCTGCTGCGGTC
ACGTGCGGCTCGCGCGCTGGGCACGCTGATCCGGTTTACGCCGCGCGTCGACCCGCTGATCGCCGAGCTCGTCGCCGGCT
CCCGCACGGCCGATCCGGGCGTCCGCAACGCCATGTTGACGGCCCTGTTCGAGGTCATCAGCAAGGCTGGCGCCAGCATG
GGCGAGCCGTCGCGGACGGCCATCCTGGCCCTGATCGACAGCGAGCCCGACGGCCACGACGACAACATGGCCATCACCAA
CGCCAAGCTGCTCGGCGCCCTCGTCAAGAACGTCCCGGCCGAGGCCGCCACCAACCTGCTCAGGAACCGCGTCGTGCCAC
CCAGCCCGACCGGCGCTTCCGCTCTCGCCCTCAACGCTGTCCTGCTGGAGTCGCCTGAGCACCTGCTCGACAGCGCAGCG
GCCGAAGACCTGCCGGGGGTGCTCTGCCAAGGGATGACGAACAAGAATGTGAGTTTTTTCTTTCCTTCTTTCCTTCTTTT
CTTCTTGCTTTCTACTTCCTTTCTATTCCTCCTCCTAACATCACAGCTCTTCATTGCCGACAACTTCATCCTTGCCACCG
GCAAATACCTCCTCGGCGACCGGCCAAAGTCCTACGAGGACACCAAGGACATCTTCGAGACCCTGGCCACCATCATTCCG
CCCGGCGGTCCGGCCAACTCGCGTCGCCTGGCCCTCGTGCTGGTGCGCACGCTAACCCGCGTGCACCCCGACGCCGTGCG
GCCTCATCTGGCCCTGCTGGCACCGCCCATCTTCGCCTCCGTGCGTGACATGGTCATCCCCGTCAAGCTGTCGGCCGAGG
CCGCCTTCATGGGCCTGTTCGACGTGCTCAACGAAGAGGCCAAGGTGTTTGACAAGTACATGAGCGGCCCGGCTGCGGCC
GAGCTACCACCCAACACCAAGCGCGTCATGGGCGACTACTTCAAGCGCGTCACCCTGCGTCTGGCCGCCCAGGGCCGCGA
GAGACGCGACGCCGAGGGCGGTGCCGGCGGGCTCGGCCTCTTTGACGACGAGGTCGAGGACGAGCGCGAGATCTGGAGCG
TCGGCAAGGTGGACATTGTGGCAGACGTCTTTGGAAAGGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62