GenePrediction:GLEAN_2807 Details

Name: GLEAN_2807
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3376362..3377248 (+ strand)
Length: 887
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3376362..3376387 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_140:3376540..3376809 (+ strand)
Length: 270
Type: CDS
Source: GLEAN
Position: GCSC_140:3376884..3377034 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_140:3377093..3377248 (+ strand)
Length: 156
>GLEAN_2807 class=GenePrediction position=GCSC_140:3376362..3377248 (+ strand)
ATGGGAGCGGCGCCGAGTCTGGTCTGGTTGATGGCAGACGGGAGACGGAAGCCGGAGGACGACGACCGATCAAGAGAAAA
GCAGGGCGAGAGGAGATGCTGGCGTTGTTCAGCCATCTATCCGACTGCTTGGTCTTTTTTTTCTTCCTGCGCCGAGACTA
ATCCGGCGTGTTTTGCAGGGTCAATTTGCGGACTCAGAAGCGTCTTGCCTCGTCCGTTCTGGGCGTCGGCAAGAACAAGA
TCTGGCTGGACCCCAACGAGGTCAGCGAGATCTCCAACGCCAACTCGCGCAACTCCATCCGCAAGCTCGTGTCGGATGGC
CTCATCATCCGCAAGCCGGTCACGACGCACTCGCGGTCGCGCGCCCGGGAGCTGAACCTCGCCCGCCGCATTGGCCGGCA
CCGTGGTTTCGGCAAGCGGAAGGGTACCGCCGATGCCCGTATGCCTGAGTGCGTATAGCCCTTGATCGCGTGGGGAAGCA
GAGACGGCAGAGACGGCAGAAAAGCATCTGACACCCGTGCAGGCAGGTCCTCTGGATGCGCCGCCAGCGCGTCCTGCGCC
GGTTACTAGTCAAGTACCGCGCCTCGGGCAAGATCGACAAGCACCTGTACCACGAGCTGTACCACCTGGCCAAGGGTAAC
ACCTTCAAGCACAAGCGCGCGCTTGTCGAGCACGTACGTTGGCGATTATTTTTAGTATTTGTTTCTCTCTCCCTCCTACT
AACACCCCCAGATTCACCGTGCCAAGGCCGAGAAGCACCGCGAGAAGCAGCTCAAGGAGGAGATGGACGCCAAGCGCGCC
AAGACCAAGGCGGCCCGCGAGCGGAAGCTGGAGAGACAGGCGGCGAAGCGGCAGGCGGTGCTGGAGGATGACGTGGAGGA
GAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62