GenePrediction:GLEAN_2808 Details

Name: GLEAN_2808
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3378445..3380163 (+ strand)
Length: 1719
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3378445..3378573 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_140:3378628..3378684 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_140:3378736..3378829 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_140:3378881..3380163 (+ strand)
Length: 1283
>GLEAN_2808 class=GenePrediction position=GCSC_140:3378445..3380163 (+ strand)
ATGATGTCGTTCCCCATCGTTCGCAGCACAGCACGTGCTTTCCAACGGCCATGGGCCACGGCCAGCGCACAGGTGGCGCG
GATGCAGAGCCGGATGGTGTCGTCGCAGAATCTGGAGGGCCAGCAGCGCGTGAGTGGACACCATACAGCTGTTTGCAGTG
GAGAGGTACTAATCTGGGTGCAGTTGTTGGCGGCACATCTGCAAGAGGCCGATCCGACCATGTACGATATCGTGGAGAAG
GTATGGCCGTCTCTCGCGTTGTCCGTCACTCTCTCTCGCTGACATGGCCAGGAAAAAACACGGCAGAAGCAGTTCATCAA
CCTGATCCCGTCGGAGAACTTTACGTCACAGGCGGTGCTGGACGCTTTGGGCAGTCCGATGCAGAGTACGTTTGTTGCGT
GTGGCGAAGATGGTGGGCGAGACTGACTGGGCGCAGACAAGTACTCGGAAGGGTACCCGGGGGCGCGATACTACGGCGGA
AATGAGTTCATCGACCAGTCAGAGCGGCTCTGCCAGCAACGAGCGCTGGAGACATTTGGGCTCTCGGAAAGGGAATGGGG
CGTCAACGTGCAGGCGCTGTCGGGGGCGCCGGCGAACCTGTACGTGTACTCGGCGCTGATGAACACGCACGACCGGCTGA
TGGGGCTGGACCTGCCACACGGCGGTCACCTGTCGCACGGCTACCAGACGCCGACGAAGAAGATTTCGTTTATCAGCAAG
TACTTTGAGACGCTGCCGTACCGACTGAACGAGCGGACCGGGCAGATCGACTACGACAAGCTGGAGGCGATGGCACTGCT
GTACCGGCCCAAGATCATCGTGGCAGGGGCGAGCGCGTACAGCCGGCTGATCGACTACCAGCGGATGCGGGCAGTGTGCG
ACAAGATCAACGCGTACCTGGTGGCGGACATTGCGCACCTGTCGGGGATGGTGGCGGCCAAGGCGATGCCGGGGCCGTTT
GGGGTGGCGGACGTGGTGACGACGACATCGCACAAGTCGCTGCGAGGGCCTCGGGGGGCTCTGATCTTCTTCCGACGCGG
CGTGCGGCGCGTGAACGCAAAGACGGGCGAGGAGGAAAAGTACCAGCTGGAGGCGGCCATCAACGCGAGCGTGTTCCCGG
GCCACCAGGGCGGGCCGCACAACCACACGATCGCGGCGCTGGCGGTGGCGCTGAAGCAGGCGCAGACGCCCGAGTTCCGC
GCATATCAGGAACAGGTGCTGGCCAACGCACAGGCGCTGGCACGACGGCTGGGCGATGCCAAAGACAAGGGCGGCCTCGG
CTACTCGCTCGTGTCGGGTGGCACCGACAACCACCTGCTGCTGGCCGATCTGCGGCCACAGGGCATCGACGGTGCTCGCG
TTGAGCGCGTGCTCGAGCTCGTCGGCGTCGCCGCCAACAAGAACACGGTGCCGGGCGATCGCTCGGCCTTGACGCCCGGA
GGCCTGCGCATGGGCACGCCTGCCATGACCACGCGCGGCTTCACCGAGCACGACTTTGCCCGTGTTGCCGACATTGTCGA
CCGCGCCGTCACCATTGCCATCCGCGTCGACAGGGCCGCCCGCAAGGAGGCTGAGGCCAAGGCCGAGAAGAGCCCCGGCC
GTCTGCGTCTGTTCCTCGACCACCTCGGCGGCGGCGATGCCGTGCCCGAGATCCTGCAGCTGCGCAGCGAGGTCGCCGAC
TGGGTCAGCACGTATCCGCTGCCCTGGACGAGCAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62