GenePrediction:GLEAN_280 Details

Name: GLEAN_280
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:750171..752310 (+ strand)
Length: 2140
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:750171..750596 (+ strand)
Length: 426
Type: CDS
Source: GLEAN
Position: GCSC_167:750647..751686 (+ strand)
Length: 1040
Type: CDS
Source: GLEAN
Position: GCSC_167:751860..752310 (+ strand)
Length: 451
>GLEAN_280 class=GenePrediction position=GCSC_167:750171..752310 (+ strand)
ATGATGAGCCCACCGCGCCGATGGCGCTCCCTGCTGGTGGTTGCAGGTCTCATGGTGTGCACGGTATTGCTGGCGACGCG
GAACAGGACCGAACTGATTGACCGGTACCACGACATCTCGCCGATGCAACCACTGCCTGTAGCGGACGCACCGAGCGCCA
AGGTGCCAGCTCCACCGCCACTGGAGGACGCGGCCGAACGGGCAAAGATGCGACTGGCCAAGCTGCCAGACCGCTACCCA
GTGACATCGTTGAAGCTGATACCGAAGGAGCGGCGCGAGGGGGCGGTGCCGCCGATGCAGAAGCAACCGGCACCCAAGGA
GAGCGAGGAGGCGCGAGAAGTGCGGCTGGGCCGTCTGGCCGCGGTGAAGGAGGTATTTGAGCGCAGCTGGAAGGGATACA
AGGACGTGGCGTGGCTGGCAGACGAGGTGATGCCGATGTCGGGGGTGCCGCTGCAGGACTACAACAAGCTGGGGAGGGCT
GGGGGGGCGGGACAATGGTGGACGCACTGGACTCGCTCTGGATGATGGGAATGCACGACGAGTTCCGGATGGCAGTGCGG
GCGTGCGCGGACATTGACTTCAGCCGGACGGAGGCGGACGTGATCAACCTGTTTGAAGTGACGATCCGGTACCTCGGCGG
TTTTCTGGGGGCGTACGAGATTAGCGGCAAGACGGAGCCAGTGCTGCTGCGCAAGGCGGTGGAGGTGGGGGAGATCTTGC
TGGGGGCGTTTGACACGCCGAACCGGATGCCGCTGGCCAAGTGGGACTGGCGAGCGTACGTGCGCGGTGGCATGCAGACA
GAGGCGGCACGGGCGATGCCGGCGGCCGAGCTGGGCTCACTGTCGCTCGAGTTCACCAAGCTGACGCAGCTGACGGGCGA
CGAGAGGTTCTACGACGCGACGGCGCGCGTGTCGGACGTGCTGGACCACCACCAGCTGCGCACGCGGTTGCCAGGCATGT
GGCCGGTGCTGGTGGATGCTGCCGTGCCGGCTTTTGACGGCGACGACACCTTTTCGCTCGGCGGCAAGTCCGATTCGCTC
TACGAATACCTGCCGAAGCAGTGGCTCCTTCTCGGTGGCGTGCTCGACCAGCCGCGTCACATGTACAGCCGCTTTCTGCC
CGTGGCCAAGAAGCACCTCTTCCGCCGCGTGCTCAACGAGCACAACTGGCCGCTCGTCTTCTCGGGCGATGCCCGCGTCG
TCGATGACCCGCAGACCGGTCGCGCCGTCGTCAACTCGCCGCGCGGTGAGCACCTGACCTGCTTTGTCGGCGGCATGGTC
GGGCTCGCCGCTCGCGCCTTTGGCGAGGCCAGCAACGACCGCGGCGACATGGCCTTGGCCGCCCAGCTGACTGACGCCTG
CGTCTGGACCTACAACGTGACCGCCACTGGCATCGGACCGGAAAAATTCTTTTACGCTACCTGCGGCTCTGCGAGCGAGG
ATCAGGCTGGCATGCGGTGCAGCTACACGCCGGACAAGTGGCGGGACGCTCTGGAGAAGCACTGGAAGCTGGCAAAGTAG
GCTTATTCTTTTTTATGCTTCTCTTTCTTTTTTCTTTTTCTTTTTCCCTCTTCCTTTTTCCCTTTTCCTTTTTCCCCTTT
CCTTTTCCCTTTTCCCTTTTCCCTTTTCCTCTTTCCTTTTTCTTCCTTTCTCTTTCCTTACTACTCCCCCTTCCCTGCTA
ACCCCCTAGGGACAGCTCCTCCGATGCCATCGACAGGCTCATGACCAGCGGCCGCATGGCGCCCGGCTACGTCGACATCG
ACGACCCCAAGTACATGCTGCGCCCCGAGGCGATCGAGTCTGTCTTTGTCATGTGGCGGCTCACCGGCGACACCGCATGG
CAGGACAAGGCCTGGCACATGTTCCAGAGCATTGCGCGCTACACTAGCACGGCCGGTGCTGTGTCTGCTGACGACCCGAA
CGGCTCTGGCGCGCACCCCGTCGCCGCTGCCGGCATCCTCGACGTCACCCAAGCCTTTCAGCCGCCGCCGATGGACAAGA
TGGAGAGCTTCTGGATGGGCGAGACGCTCAAGTACTTTTACCTCGTCTTTGCCGAGTGGGATCTCGCCAGCCTCGACGAG
TGGGTCTTCAACACCGAAGCGCACCCCTTCCGCCGCGCCGGCACGACTGCCCTGCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62