GenePrediction:GLEAN_2811 Details

Name: GLEAN_2811
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3394814..3395380 (+ strand)
Length: 567
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3394814..3395200 (+ strand)
Length: 387
Type: CDS
Source: GLEAN
Position: GCSC_140:3395228..3395380 (+ strand)
Length: 153
>GLEAN_2811 class=GenePrediction position=GCSC_140:3394814..3395380 (+ strand)
ATGCCAGCAGAAGCGTCCCACAACATCCCCGGCCAGGGCTTGGCTCGTTTGCGGCAGGCAGACAGGCTTCCGGGCAATGT
GACGAGGCGAACGAAACGCTTCTTACACCTCGTTTGCCCCGTCGCATCCTTGCGCCCTCCAGCGCCTAAAGGCTGGTGCT
CGCGCCCCACTTTTTCCAGCTCGTCAGACTGGCCGCTTTTCCTTTTTCCGTTTTCGATCGCGCCTGCCAACTATGAACAA
ACGACTGAATCTTCCAATCCACGGCCCATATCATTTCGCTCCCTTCTCAAGCTCGCCTCCTCCTCCACATCACATCCGGC
AGCACATACGCCACCCCTCGCTCTCCCCTTTCGTGACATTGCCGGACTCGGACACGAGAGGGAATCGGTACGTGGACCCT
GTATTTTACCCAAGGCATTTATTAGGCACCGCATCTCGACTCCGCCCTTGACGTATGACAACCGGGAGGGCGAAAGGCTC
GAAAACTCTTCTCGCCGGAGCAGCATCATCGTGCCATCGATGGACGGAACGGTCCTGTGGTCCTCCTCTAACACGTACAC
CGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62