GenePrediction:GLEAN_2812 Details

Name: GLEAN_2812
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3395572..3398595 (+ strand)
Length: 3024
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3395572..3395826 (+ strand)
Length: 255
Type: CDS
Source: GLEAN
Position: GCSC_140:3395885..3397025 (+ strand)
Length: 1141
Type: CDS
Source: GLEAN
Position: GCSC_140:3397087..3397615 (+ strand)
Length: 529
Type: CDS
Source: GLEAN
Position: GCSC_140:3397676..3397730 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_140:3398208..3398382 (+ strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_140:3398483..3398595 (+ strand)
Length: 113
>GLEAN_2812 class=GenePrediction position=GCSC_140:3395572..3398595 (+ strand)
ATGGCGGCACGAAAACTGCAGCAAGAAGTGGACAAGTGCTTCAAGAAGGTGACGGAGGGCGTGTCCGAGTTCGACGCCAT
CTACGAGAAGATCGAGCAGTCAAATAACCCGGCGCAGAAGGAGAAGCTGGAAGACAACCTGAAGCGCGAAATAAAAAAGC
TGCAGAGATTACGAGACCAGATCAAGACATGGGCGGCCGGCAACGAGATCAAGGATAAGGGCCCTCTGATGGAGCAGCGG
AGGCTGATTGAAACGGTTGGTGCATGAGCATGGTAGCTGAACGGTCCGTCTCGGCTAACACTGCCGCACACAGCAAATGG
AGAGGTTCAAGGCCGTCGAGAAGGCCATGAAGACAAAGGCCTACTCGAAAGAGGGCCTGTCGGCCGCAACAAAGCTCGAC
CCGAAGGAGCAGGCAAAGGTCGAGACAGGCGAGTTTCTCAGCTCCCAGGTCGACGAGCTGGAGCAGCAGATCGAGTCGCT
CGAAGCCGAAGGCGAAGCCATCCAGGCCACCGTGAAGCGAGGCAAGATCCACGGCGCCAAGGCCGAGCGCATGGCCGAGA
TAGAACGCATCATCGAGCGGCACAAGTGGCACCAAGGCAAGCTGGAACGGTTACGTCGCTCGCTCGAAAACGGCGCCATC
GACATCGAGCAGGTCAACGACCTGGAGGAGAGCATCCGCTACTACGTTACCGACAACCAGAACGACGATTTTATGGAGGA
CGACACCATGTACGACGACTTGAATCTCGACGAGGAAGAAGAGGGCTTCGGCCTGAATGGCGATGACAGAGTCTCCTCAC
AGGACACGCAATCCATACAAGGCGATCTCGGCGATCTGGACGTGAAGCCACCAGGGACAAGTAGTGGCAAGGGTCGTGCC
ACCACCGATTCGGCCTCCATCTCTTCTTCTGGCCGCCGCCCCTCCGCACAGCTAAAGTCCCCACTGCCAACACTAGCAAC
TCTGCATACCCCTCTACAAACGCTTAGCAATGGCATCTCTACCGCCGTGGCCATGAAGCCGGCATCCATACCGGCACGAC
CAGCGGGCGAAGGCCTGAAGTACGCGTCGGCCGCTGCGGCCGCTGCCGCGAGCGATAGACTCAACGTCGGAATAGCCCCG
CTACCGCCACCGCCAGGCGTAGTCGGGCCCTCACAACAAACCCAGCTGCCAGCCGCCATTGCACCCTCGTTGCCCGCCGC
GCAGGCGAGCAGAGCGATCGCAAGCGCAGCAAATTCCCCGAAGCCGCCGTCCGCTCAGCCGCATCAGCACCATCAACAGC
AGGCAGAGAAGGTGGTCCCTCCATCGGCAGCAGGTGCAGCGTCAGGCGTTGCATCGGGATCTACGGTGAAGCCGGAAAAC
GCACGATCGGCGAAGGCAAGGAGCGCTGCAGCCTCTACATCCGCGTCCACGACGTCAACACCGGCACCCGAGCCGGCAGA
TGCCGCAGGCAAAGGTAGGGCAGTGCATCGGACCTCCAAGACAGATCAGCTGCTAATGAACCCTCGTCTCTTCAGGCTCT
CATACGAACGGTACCACGAACGGAGTCAAGACCGCCACTCCTGTCACCAAGGAGGGGGAGCAGGCCGAAGAAGAGTCCAT
CTACCACCTGCCTTCCTCACTACAAGACCTGGTCGAGTCATTCGAGGTGACAAAGAGCCGACCGCCACAGTCGAACCCGA
CTACAGGACTACGCATGTTGGCCCAGTCGGTAGCCAACGCGCCCGAAACGATGGATGCAGAGCCTCCACGTCGATACCAC
CCAGAGGTGCGGTTCCACTCGTCTTCGAACTTCCCACAAGAACCGCTGGCACTGCTGGATGACCCTCGGCTGTACGCTCG
CATCGAGCCAGACACGCTCTTCTACGTGTTCTACTACAAGCAGGGGACGTACCAACAGTACCTGGCTGCCAAGGCGCTCA
AGGACATGAGCTGGCGCTTCCACAAGCAGTACCAGACATGGTTCCAGCGGCACGAGGAGCCCAAGAGCATCACAGAGGAG
TTTGAGCAGGGCACCTACCGCTTCTTCGACTACGAGAGCACATGGTAAGCAGGGTGGAGACCATGTTTTTGTCGTACCCC
TTCCTTTGCTGACACGCGGTACAGGATGAACCGGAGGAAAGCAGATTTCAAGTTCGTCTACAAGTTCCTGGAAGACGATG
TATGATGGCGCAACGGCGAGAGAGCGGAGTGACGGCGTAGTTTTTACTGCCGGCTGCAGCAAAGGCTCTATCAGTTTTGA
AAGCTCTACTCTTTTTCTTTCCATTTTGTCCCCATGACGTGGCTTGGCTTGCTATTTGACACTCGTCGGTCTCTTCCATC
GAGACAAGGAACCCGGGTACGGTTTATTTTCGGGTTGTCAGTTTTAGTAAAAATCATTTGACTGGAGTGGACCGGGAGAG
GGGGAGGATGCATGGGTTTGGGAACCCCAAGAAATCGGCAATATTAGAGCGAGGGCAGACATGGCAGCTCGGCCTGCTTT
CCTTCTGCTCCCTTCCTTTCCTCTTTCTGTCGCCTTCATAAGCACAGGGCGAATTACATGGCATTGTTCAGAGAAGTAGA
ATTCGACATGATCGTGTCCTGATTGGTCTTGGCTGCCTATTGGCTTGTCCGTCTTGCTCTCGTCCAAAGGGCCTAGAATG
CCTTGCCTGATCTTCGTGTTACGACAGGCCGCCATCCAGGCTGCAGTGCGCCGTTTCACCACGACGAGGCTGTCATGAGG
ACGATGCCAAAACGGCTGGCTTACGGCCCTTCCGAGATCGACTCGTTGGTTTATGTGCAGGAAGATGACCTCAATGTATG
CTCCCTCTTGGGTAAGAAAACTGCTCGCCTGCATTACCTAGCGCCGCCTAGGCTCTTCCACTCCTCGCCTTACGTTTCTG
TGTCCCGGTCATCCTTTCGCCTTCCTGACAGCCTTTGCTTTCCTGGCCTCGCTCACTTCTGCCGCTTCGTACTCGGGCTT
AAAACGCACTGTGAACCTGCAAGCAACCCGATGGAAACAGGGCGCCGCGCCCGCTCTACTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62