GenePrediction:GLEAN_2813 Details

Name: GLEAN_2813
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3401293..3402504 (+ strand)
Length: 1212
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3401293..3402504 (+ strand)
Length: 1212
>GLEAN_2813 class=GenePrediction position=GCSC_140:3401293..3402504 (+ strand)
ATGATCAACTCCATGGGCACCACCAACTGGACAGGCTACGACCTTGAAGCTTACAGCCAGTTTGGTGATACTTCTTCATT
CATGACCCCTTCGTTATCTAGTGGAAGCTCTGGAAGCTCTGGAAGTATCTCAAGAAGTATCATGGACGGCGATGAGAATA
TGACGCCAGGCAATTTTGGGTACGGCGAAACTGGCGTATCCTTCGATACCAACTGCTTCAATGAGATCACTGGGCAGATG
GACTTGTATCAGCCCGATTGGGAATGGGAACCTCAGGACGACGCGTACTTGAGTCAGTTTTTTTCAGACAACGCGGAATC
AAAATTGGAACTGCCCAACAATGACGACATACCGCTCGCCATATCGTCAAACCAATCGTCGCAGCCGAGTATGAAAGTCC
ATAGAGGCAAGAGCGTCAAGAATCGGCAGCCTCCGAATGGTGCGCCGAAAAGGAGGCACAAATGCCTAGGCTGTGATAAG
AAGTTCTCACGAACTGCCGATCTTCAGCGCCACGAAAAGCATGTCCACCTCGATGAGCGCAGCAAGCTGAATATTGTCTG
CGACTATACGGAGTGTCCGCGGAACAAGCAGCCCTTTTCCCGCAAAGACCACTACCGCGAGCATCTGCGCGACTCTCATG
GCGAAGATATGACGAAGCGGGGAGGAAACGTGCATCAGTCAGCGGGACCGCCTAAAAACATGGCATCTTCTGCCGGCAGC
GGCAAGGGTAGTAAAGTGGGGGACAACGGAAAGGGAAAGGCCGTGAAGATGGAGCTTCCAGAGAGCCTCAATTACAGCAA
CTATGAGCAAGATGACGACACTTTCGAGAGAGAGCACGGTGACAATGCCGTCAGTAATGCCGACGCACTTGGTTTCGACT
TTAATGCGAATGGCGAAAGCTCTACTTTCAATGCATTAGCCGACAAGGAGGAAAAGTCGGGCTCGGAAGAGGAGAGACTG
CGAAACTGTCGTGTGGACCTCAGCTGGTGGCGGTGCTCTCGTTGTTTGCTGAGGGTACCGCTCATTAGAGACGATTACAA
GCTGGACTGGACGTGTGGTAACCCGACGTGTAGAGTCGACATCGAGCCAATAAGGAAGACGATACGCGAAGAAATGGCTG
CTGCTGCTGCTGCTGCTTCTGCCAGGCAATGTCCTTCTGGTGATGGGGTGAAGCTCTGGGGGACCGAGCTGAATCATCAT
GGTTACAGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62