GenePrediction:GLEAN_2814 Details

Name: GLEAN_2814
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3404046..3405518 (+ strand)
Length: 1473
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3404046..3404352 (+ strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_140:3404492..3405031 (+ strand)
Length: 540
Type: CDS
Source: GLEAN
Position: GCSC_140:3405094..3405518 (+ strand)
Length: 425
>GLEAN_2814 class=GenePrediction position=GCSC_140:3404046..3405518 (+ strand)
ATGGCATCCCAGCAAGCCGGCGTGGCCACGACGGCCTTCCAGAAGATCAAGGTCAAGAACCCAGTCGTCGAGCTTGATGG
CGACGAGATGACCCGTGTCATCTGGAAGGACATCAAGGACAAGCTGATTCTGCCCTTCCTCGACATCGACCTCAAGTACT
ACGACCTGGGCCTCGAGCACCGTGATGCTACCGACGACAAGGTCACGACCGACTCGGCCGAGGCCATCCAGAAGTACTCT
GTGGGTGTCAAGTGTGCCACCATCACGCCTGACGAGGCCCGTGTTGAGGAGTTCAAGCTGAAGAAGAGTATGTTTTCGCT
ACCCTCTCTCTTCCCCTCTCCCGCTGCCCCTCTCTCTCCCTTGACCCGTTTGGCCCAAGCGGCTTGCTCGCACACCCTTT
CGCCCGTCAGCGATGGAGCGGCGGATAGATTGACTGACGGATGCAGTGTGGCTGTCCCCGAACGGAACGATCCGCAACAT
TCTTGGTGGCACCGTCTTCCGTGAGCCCATTGTCATCCCGCGCATTCCCCGGCTGGTGCCTGGCTGGGAGAAGCCCATCA
TCATTGGCCGCCACGCCTTTGGCGACCAGTACCGCGCCAAGGACCGGGTGATTCCGGGCAACGGCAAGCTGTCCATGGTC
TTCACCCCGGCCGATGGCGGTGCGCCCGAGGAGATTGAGGTGTACGACTTCAAGACCGGCGGTGGTGTTGCTCAGACCCA
GTACAACACGGACGAGAGCATCGAGGGCTTCGCCCACGCCTCGTTCAAGCTGGCTCTGGACAAGGGCCTGCCGCTGTACA
TGAGCACCAAGAACACGATCCTGAAGAAGTACGACGGCCGCTTCAAGGACATCTTCCAGAAGTACTACGACGAGCAGTAC
AAGCCGGAGTTTGAGAAGAAGGGCATCTGGTACGAGCACCGCCTGATCGACGACATGGTCGCCCAGATGATCAAGAGCAA
GGGCGGCTACATCATGGCGCTGAAGAGTGAGTTCCCGGACGGCCGACAGGCACCGTGCTGGCAGAAGACGGGCTAACCAG
CGGTACAGACTACGACGGTGATGTGCAGTCGGACATTGTGGCCCAGGGCTTCGGCTCTCTGGGCCTGATGACGTCGGTGC
TGATCACGCCGGACGGCAAGACATTTGAGTCCGAGGCTGCCCACGGCACGGTGACGCGCCACTACCGCGAGCACCAGAAG
GGCCGCGAGACGTCGACGAACCCGATTGCATCCATCTTTGCGTGGACCCGTGGTCTGGCCCAGCGTGGCAAGCTCGACGA
GACGCCGGAGCTGATCGCTTTTGCTGACGCCCTGGAGCGCGCCTGCATCGAGACGGTCGACACGGACGGTATCATGACCA
AGGATCTTGCCCTGGCCTGCGGCAAGACCGACCGCGCGAGCTACGTCACCACGACCGAGTACCTCAACGCAGTCGAGCGT
CGCATCACCAGCAACCTGCAGGGCAAGCTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62