GenePrediction:GLEAN_2816 Details

Name: GLEAN_2816
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3414085..3416025 (+ strand)
Length: 1941
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3414085..3414718 (+ strand)
Length: 634
Type: CDS
Source: GLEAN
Position: GCSC_140:3415106..3416025 (+ strand)
Length: 920
>GLEAN_2816 class=GenePrediction position=GCSC_140:3414085..3416025 (+ strand)
ATGGGGGCCAGATTGCCGGGCCAGTATGCAGCTCCCTATCTTGCCAGAGCTCCAAACATGGGAGTTAGAATGTCGGGCCA
GTACGCAGCTCCCAACCCCGTGAGCTTCTCGAACATGGGGGCTGGAGGTCCTGTACAACGACTTGCTCCCGGGCAGGCAC
AGAGCACTGCAGGCCGCAGACACATACCCGATTATCCAATACGACTTGCACCCGTGCAACGAATTGCTCATCAGAGCCAA
GGACCTCAAAAGCCAGCCAGAAGTGCGACGCTTACGTATGGCATCGCCGACAACAAGACGACAGCTCCTCAGGTTCCTTC
CCATGACAATCGAAGTAAATCATCGCTTCAAGAATTTGCTGGACAGATCTCTGCGGCGGCAACTGAGCAGCCCCCGATAT
TATTCACCCCTGATCCTGTACCTTCCGAGTATTTCCACAAAGCCAATATTCGCGTTGCAGACCGCCTCGCAAAAGGAAAC
GGAGTAGCATACCTTTTGGAGAAATCTCCGACAGACACTGGGACATTTTCTGTCTTTCTCGAAGGACTCAAGTACCTCGA
GTATCCTATACTGGACATGGTCAACTATATTGCTAACTCCCAAGAGCTCTGTCCGCAGTTCAAAGAGGCTGATGGTGTGT
CTATAATCACCACGTCGCTTGTATTCGGCTGTCAGAGTGAAATTGCTTTGTTCATGAGCAAAGTTCGAGCTCTACAGGAA
CGGAGACCTGCTGTCCCTGACACCAAATCTGACGGTATTCTGCCAGCAAACGAAATTACCGCCGGAGTTTGTGCTCCACT
AGAGCCTTCACGAGCGAATCTGAACAAGATCCCTTGCTCACCTGGGAGTGCCTCTTCAGATTTTTTACCTGAACCAAAAC
GACAAAGACCTGCAGTCTTTGCTGAAACAAAGACGAAAGAAAGACTTGTAAAGCAATCTGGAGGGACAGCTCAAGGGGAG
AAAGCCACAGCCTCAAACGGGACTACTTGGAGCAAATATTTCCCAAGTACTCTGGCAGCAGGAGAATCGCGCGAGTGTGC
TGCTTCCAAAGCAGCGGCTCCTAAAAAGGACGTTTGTACTCCAGCTACGAGCAAGACAGCACTTACGACGCATGCCTCAG
CTGGTGCTGCCTTAGAGGCTAGCCTCGTTGGTCTTTCCCTGTCCCCACAAGTGCTTCCACCAAGACGTATAACTAGCTCC
GGAAGCGTATCGTCATATGCGATGGATCTGGGCACCCTGGACTTCGCTGTCAAAGATTGTGACAACGAACAGTCTCAGAG
CGCACAGGTGGACGAAACTGATGACCTGGCACGCGATTTGCAGCAGATCTTACCAACTTTCGAGAAGGTGAGCCAGGCGC
TGGTTTCTATCAGCGAAAGCAAAAGAGAACTTGCTGCAAAGAGAGTGTTGCAAAACCTGAAAGGAGCATCTGGCGCAGAT
GAACTTCTCCGCACGTTGCTCTTGCTATCAGCCAAGTCTGGTGCGGAAGCTTCTCTTGAAACGGTACCGTCGTGCTGCGG
TCCAAAGTACTCCCGGAAGAAGCTTCTTCACTTGCGTTCAAGTGCCTGCATCCCGCCGAAATGGGTTTTCCATACCGGCT
TTCTCCCTGTCAGACCCCAAAGAAACGCAGAAACCACAATCAAGGCTACAGGAGAAAGCGGTCAGCCACAAAAGACGAAG
GAAAATGAGACGGTGACAAATGTGAATGCCGGAACTCAGATGGATAGAGAGCAAGATTCAATGTCTATGACGAGCATTTT
GACGGCCCTGGTGGACATCATGAAGACACCTGTATCCATGTTGGACAATTGCGAAAACCCGACAGCTGTGCCTGAAGTCA
GTCAGGTGGTGCCATCGACCCCTGTCAAACAGAAGAACACTGTCGGCACTGATCGCGGTAACAGTGTGACGAAAGGCCTG
AACAGCTCCAGATGGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62