GenePrediction:GLEAN_2817 Details

Name: GLEAN_2817
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3418546..3426161 (+ strand)
Length: 7616
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3418546..3418806 (+ strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_140:3418929..3423112 (+ strand)
Length: 4184
Type: CDS
Source: GLEAN
Position: GCSC_140:3423341..3424038 (+ strand)
Length: 698
Type: CDS
Source: GLEAN
Position: GCSC_140:3424112..3424330 (+ strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_140:3424472..3424619 (+ strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_140:3425143..3425316 (+ strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_140:3425368..3425454 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_140:3426065..3426161 (+ strand)
Length: 97
>GLEAN_2817 class=GenePrediction position=GCSC_140:3418546..3426161 (+ strand)
ATGCTGGATAAAACAACAATACCCCTTGCCAGGACATTGCTCGACCTCACCGTCCCGGTGACCGCCAGACGAGTAAAGAC
GTCGATCTTCCCGGATCTCTGCTACAGCTCGCGGGCCTTTTTCTCTCTGACTGCCGTGCTTTCAACCGGGGCTCAGAGAA
AGGCCGAGAAAAACGATAATACGGAACGACTCGAAAGCGGCTGCACAACACTCGACCGCTCCAGAACATCACTCCTAGCA
CTGCAGAGTTCGTGGAAAGTGGTATACCGCCTTTTGGCCTTGCCTTCTGTAGGCCGGGGTGTTCCCCGTGAGTTCAGTCC
TTGGGCATCTCCTTGTCTCTGCATGTCCTTGTTCTTTTCAAACGGTCTTGCTGATGAGCGTAGCTCTACGTCTTCTGCAT
CAGGATGGGAACCGCTGCGGAGGATGGCTCCCGGCTGTCGTCGAATTCGGCGGCGAAAGACACAGACCTGCCATCGATAC
CCGAAGCGCCCTCTGCCGAAGCCAAAGCAACCAGCGCGGGAAACGGGCCAGCCAATGGGGCCTCCTACAACAGCGAGGCC
AGCGACGCCGATGGAGCACCGACAATGAAGAGATTATCTTTTGCGATGAGACTTCCCAGCCTTCGGTTTGAGGCGGAGGA
CTATCTAACTGGCGGATTTGCACACAGCATGGCGGTGTCCGCGGGTGACGAGGCTGCAGGCGGGACTGCTTCGCCAGGTG
GCATGTCTCCCGGAATATCGCCAGGAGCCATTGCCGGACGGGCAGACGGCATGACGACGCCACAGATCCTAGAAGAGGGC
GAGCTGATGGAGTCGCCACCGGGGACACCAGGGCTGTCTGCCCGGCGAAGTGTGCAGTTCTCGGGACCGGATATCGTGGT
GGACGCGCCATTTGGCTCACACTCGCGGCAGAACTCGCTGGACGCGGGCAATCCGTCGAGCTCGCGATCACGGGCGTTTA
TGGCCAAGCTGAAAGCACTGGCGGTGCAGGGAGGGCTGCCATCGCCTCGGTCGCCGGGGACAGGATCGACGGGTATGGCA
GCCGACACGGCATACTCGTCGGCCACGGGATCACCAACGATGGCCCGCGGAAGCCGTCGGGCGCGGAGCCTGCAGGAAGA
GGGCAGCGACGAGGATGCGGACGCGGAAGAGACGGCGGATGAGGACACAACGGAAGAGACAGCGGCGCAGTCGAAGAAGC
GGAGACGACGGACACACTACCGGCCACCACCGCAGCGGCTGTCGACCAGCGGGGCGCTGTCGGTGGGCGGGATTGCGACG
GAGCCAGGGACGCCGGTGCCGACGAGCAACCGTCTGCAGGCGCTGCTGCAGCGACGGGCAACGATGCCAGATGTAGCACA
GCACCGCGGCGGACTGTCGGAGGGCGAGGGTCGCGACCAGCTGGACCGACAGCACAACTGGCGGCGCGGCAGCATGTGGA
TGGGGCGGTCGGAGGAGCACGAGGAGGCAGACAGCCAGGGCGGCGGACGGACGGTCGGCCACTTGCGACGGCGAACAGCG
TTTGGCGGCGGGGCATCGGACAACGAGGCGGCACTGACGTCGCGACGGACGTTCTTCGCGGGCGGCGAGAAAGCGACGCT
GTACGGAGCGCAAAAGTGGCGGCAGGTGAAGAACACGTGGAAGTTTCTGCGGCAGAAGCGGGAGGACCGGTTCGACTACC
TCAAGTCAGCGGAGCTGATGGCGGAACTGCGAGCAGGAGCACCGGCAGTGCTGATGCTGGCGAGCATGATCCAGCGCGAC
GAGCACGGCAACAAGCGAATCCCGGTGCTTCTGGAGCAGCTGCGGCTGCACGTCAGCGACAGCACACCGATGCAGGACGG
CGACAGCGAGCGACACTGGCTCTTCACGATCGATCTGGAGTACGGCAGTGGACCCAGTCGGATGAAGTGGACGATCAAGC
GGACGATCCGCGAGATCCTGGAGCTGCACTGGAAGTACAAGCTGGCGCTGCGCAACGACAAGTACCTGCACACGGTGCTG
CCGGTGGGCTCACGGCCGAAGCAGCCGCGGTTTCCGGTGTCGGTGTTTCCGTACGTGCGTGGGCTGCGTGGGCTGGAGAT
GGACGACGAGGACGACGCGGGCAGCCTGCACGGCGAAGACGATGCGGCGGATGGAGCAGCGGATGGAGCAGGAAACGGGG
CGACAGACGGGCCGGCAGACAGAGGCAACGCAACAGCCGGCGAGATGACGGCTGGCGAAGGCACGGCGACTGATGTGGAG
GGCGGCGGTGGGATGCGGCAGCGCCGAAGGACACGGATGACAGTCCTAGGCATGAGTCGGCGATCGTCGGCAGTGATCGG
AGCGGACGGCAGCGGACTCAACGCGGACGGACAGGCGGCACAGGACGAGGCGGCATTGCGACGCAAATACGTGGATCGAC
AACAGCGGGTGCTGGGAAAGTACCTCACGGAGATGATCCACTGGCTAATCTTCCGGGCAGACAGCAACCGGCTCTGCCGT
TTCTTGGAGCTGTCGGCACTAGGAGTGCGGCTGGCGGCTGAGGGCAGCTACCACGGCAAGGAGTGCTTTCTGCACATCCA
GTCGTCCAAGGGGCTAGACTTTCGGCGGGTGCTGACGCCCGGCAAAGTGATCGAGCGGCACAGCCGCAAGTGGTTTCTGG
TGCGGCAGAGCTATATTGTGTGTGTGGAATCGCCAGAGAACATGAATATTTACGACGTGTATCTGGTGGACCCCAAGTTC
CTGATCGTGTCGAAGAACGCGAAGCGGAAGCAGGCCGAGGCGGCGGCAGCGGAGAAGGACCGGACTCGGAAGGCCAAGAA
GGCCAAGGCCAAGGGCACGGGCACGGAGCTGGACCTGACGAGCGAGATGCTGACATCGAAGCACCACACGATCAAGATCA
CGACGTCGGAGCGCAAGGTGAAGCTGTGGGCGCGCAACCAGCATCTGATCGGGCAGTTTGAGGACTCGATCGTGGACATG
CTCAAGCAGACGGCATGGCACCAGCGCCACCGATTCGACAGCTTCGCGCCGGTGCGCGACGGGGTGTTTGCGCAGTGGCT
CGTAGACGGGCGCGACTACATGTGGAACGTATCGCGAGCGATCGCGATGGCCAAGGACGTGATCTACATCCACGACTGGT
GGCTGAGCCCGGAGCTGTACATGCGGCGGCCAGCGGCAATCAGCCAGAAGTGGCGGTTGGACCGGTTGCTGCAGCGCAAG
GCGGGCGAGGGCGTCAAGATCTTTGTGATCATCTACCGCAACGTGGAGGCGGCGGTGCCGATCGACTCAGAGTACACCAA
GTTCTCGCTGCTGAACCTGCACCCGAACATTTTTGTGCAGCGGTCGCCGAACCAGTTCAAGAAGAACCAGTTCTTCTTTG
CGCACCACGAAAAGATCTGTGTGGTGGACCACGACGTGGCCTTTCTAGGCGGCATCGACCTCTGCTTCGGGCGATGGGAC
AGCCCGCAACACACGCTGGTGGACGACAAGCCGACCGGATTCGAGGCCGCGATGGATGGGTTGCCCAAGGACGCAGACCA
CTGTCAGCTGTGGCCGGGAAAGGACTACTCGAATCCGCGCGTGCAGGACTTCTTCAGCCTGCGCGAGCCATACAAGGAGA
TGTACGACCGGACACGGGTGCCGCGGATGCCATGGCACGACGTGGGCATGCAGGTGGTGGGCCAGCCGGCGCGTGACCTG
ACACGACACTTTGTGCAGCGGTGGAACTATGTGCGGCGTGGACGCAAGCCGACGCGGCCGACGCCATTTCTGCTGCCGCC
ACCCGACTTCCGACGCGAGGATCTGGAGGGCCTCGGGCTCTCGGGCACGTGCGAGGTGCAGATCCTGCGGTCGGCGTCGG
CCTGGTCGCTGGGCGTGATGGACGTGGAGTGCAGCATCCAGACGGCGTACATCAGCATGATCGAGGAATCGGATCACTTT
GTGTACATGGAAAACCAGTTCTTCATCACGAGCACGGAGACGCTCAACGTCAAGATTGTCAACCGCATCGGCGACGCGCT
GGTCGAGCGGATCGAGCGGGCACATCGCAACGACGAGGACTGGCGCTGCGTCATCATCATCCCGCTGATGCCGGGCTTCG
AGGCGTCAGTGGCCGACCAGGAGGGCACGAGTGTGCGGCTGATTCTGCAGTGCCAGTATCGGAGCATCAGCCGGGGCGAG
AACAGCATCTTTGGCCGTCTGCGGGCGGCCGGCATCGAGCCAGAGGACTACATCCAGTTCTTCAGCCTGCGGCAGTGGGG
GCGCATCAACAACAAGAGCGTGTTGACGACGGAGCAGCTATACATCCACGCCAAGGCCATTATTGTGGATGACCGCGTGG
CGCTGATCGGGTCGGCCAACATCAACGAGCGGTCGCTTCTGGGCGACCGCGACTCGGAGACGGCGGCCATTGTGCGTGAC
CGCGACATGATCTCGTCCACGATGGGTGGCGAGCCGTACCTGGTCGGCCGGTTTGCCCACACGCTGCGCATGCGTCTGAT
GCAGGAGCATCTTGGCCTGGACACGGATGCCATTATGGAGGAGGATCGCCAGCGCGAGGCCGAGTTTACGGCCGACATGG
ACCAGATGTATGGGAGTGGCGAGGGTGAGGATGAGGGTGAGGGTGGGGGCGAAGGCGACGACGAGGGCGGCTATCGGGAC
GTGGAAGACAGCGACGACGGCGACGTGGATCCGGGGCAGAGCAGCACGGCGGCAGCGCGGGCGAGCGAGCAGGTGCGGGC
GGCACGGATGAGCGCGCAGGCGAGGCTGAGCGGACTGAGCGGGCTGAGCAGACTGAGCGGACTGCAGCGGTACAGCGTTA
ACGGCGCGGTCGACTACGGCGAGCTCGCACGCAACATCCGGCTGGCGCTGTCGGGTGAGGACGACGACGACGAGGAAGGC
GAGTCTGAGGCAGCCGAGATGCAGAGAAAACAGACGCATGACGTCGAAGGGGGGGGTGAGGACCGATGGTCGGCAGCGAG
AAGCATCGGGGGAGATTTGCTGCGAGACTCGACGGTTGTGGATGGTCGAGAGGTGTTGGTAGGAGAGGGAGAGGGAGAGG
GAGAGGGAAGGGAGAAAGGGAAAGGAAAAGAGAAAGAGGAGGAGAAAGAGGAGAGGGAGGACGAGACAGAGATGTGGCAA
AGCGATGGAGAAGCCGAAATGCAGGCAAACGACCATGTTCAGCAAAAGGAACCCCAGGAAAACGAAGCAAACGAAGCGCA
GCAAAACGAACCCCCGTCGACCTGTCCGCTGGCCTTTGACATCCGACTGGCACAAATCACAAAGGAGTGCATGCGAGACC
CAATCGACGGGGCCTTTTACGACGACGTGTGGGCGCGCGTGGCCGAGAACAATACCAAGATTTACCGGCGCGTGTTCCGC
TGCATGCCCGATTCCGAAGCCACCAACTGGCACGAGTTCCAGAACTTTACGGCCTACAACCTGCGCTTCCAGGAAAGCAT
GGAGAACCGGAAGAAAAACACGACGGCCGAGGCCGAGGGCGGGAGCCGTCCGAGTGTCAGCCGGGGCAGCCATCGGGGGC
GGTGGTGGTGCCGGAGCCGGCATCAGCGTTTCGGCCGCGATGGCAGACGGCGTCGGCGAAGAGGCACAAGCAGCCAAGCC
GGAGATGGAGAAGGCGGCAGCAATGGAGGATGTGCTGAAGCACCGGCCGTCACGCGACGAGTCCTCCGTCCTAGAGGTGC
CGAACGAGAAGGACAAGGGGGAGAAGGGCACCGAGCGAAGAGCGACTTTTTCGACACCCAAAATCAGCTACGATGCAGCA
GATGGAAATGGAAGCGGAAACGCCAGTGGAAACGCCAACGCCAACACCAACACCAACACCAATCCCAACCTCCTCAACGC
CGGCTTCGCGCCCACATTCGGATCGGTCAAGCGACGAAAGCGGGCGACGACGCGCAGCAGTCGGCGTGGACTGCATGGCG
TCACAGAAGAGCTGCTGTCCAAGGAAGACGCCGAGACGCTGCTGCAGCTGGTGCAGGGCCACTTGGTGCAGTTTCCGTAC
GACTGGCTCAGCGTGGAGGAGAGCAACGGCAACTGGCTCTACCAGGTCGACCAGGTGGCGCCGCTGCAGATTTAGTAAGT
CCTGGAATGCGAGCTGGCCGAGTTGGACGAGATGCTGACGATTTCCAGTAATTAAACTACGAGCGTTGGACGACAAGACC
AGATCACGTGACCGCACAGCATGGCGTATGGGTCTCTGCTTATTACCTTCTTTACTTCTTTTGGCGAAAAGCATAATACG
GCGAGGACGCAGTTTGGTATTTACAGGCGACGATAGAATGCATATCTTGCTTTTCTTGCGAGCTGAGGCAAAAACATGGT
GATCACCCCACACCTCATCTGGACGCCTCAGAAAGCACGACTGTTCAATCCTCAGCAAAGCCGCCGTGCAACCGGAATAC
AGACGAGGGCCGGGCAACCGTGGCACGCTCGTATTCCGGCGTCGTGCACATGCCGTCGTAGTCTCACAAGCATGCAGCTG
CTCGTCGACCGTCGTATTCCGTCCGTATAAGAGCCGCCTGTTTTCTGTCCGCACTCGCAACATAGGCCTTCCCACCGCAC
TCCTTCTTACCACGCGCACCACTACCATGAAGTCCAGCTCTGTCTTCGTCTCGGCCGCTCTTCTGGCCGCCTCGGCCACG
GCCCAGACCACCTCTGCCTGTGCTGCCGAGAATATTGTGACGGCCTGTCTGAGCACCGAGAATGCCCAGCTGGCCAGCTG
CGGCACCAGCGATTGGGACTGCATGTGCAATGCCTATGTGAACATCATCACGTGAGTACCTCAACCACAACGCACCACCT
TCACCCTCCACTGACAGCCCAGCTGCTACAACAACTGCCCTGACGACACTGCTCGCAACTCTGCCGTCGGCCAAAAGGAA
CTATACTGCAGCTACGCCAGCGCGTATCCGTCGGCTGAGTCCACCGTCAAGATCACCGGCACGGCCACCGGCACGGCCGC
CGTCACCACCACTGCTCACACAACTACGGCTACCACCGCTCACACAACCACTTCTTCCTCTTCCTCTGTCTTCGTCGCCA
CCGCCTTCGCTGCCGCTGCCACCGGTGCCGCTGCTGACCACTCTCTCCACGCCGGCGGACTGTTCGCTGCCCTCGTCGGC
GCTGTCGCCGCTCTGGTCTAAGCGGGCAAGCAGAACGGGACGGGAAAAAGAGCATGGTTGATGGAGAAAAAGGGGACGGA
CGTGTCTTATATAACTTTCTACTTACATTTTTTTTACGCTTTGTAATACCAATGTCACGTGCATTACTCCAGCACTAGCT
TCGCACAATCAAGAAGATGGACACTTCAATTCTCAGCTTCATAGCCGGCCGTCTGCTGCTCTGGTCTTCGGGCTTCAGTA
TGTTCGGATTCAAATATGTACATCGAGAAAAGCCGTCGGTCCAGCGGATCGCTAGACAACAAGAGGAGCTGCCCAAATGC
AGGCAGACTGCCGCACTACTCCTACACAGAACGTATCCATACAATTTCTGTAGCTTCTCTCCATCCAAACACAACGCAGT
AGCATCAACGCACCGCTGACCACAACCGAGACCGCCGCCATGCTTAAGCCAAAACCCGCAACCACGACCTGCGTTGCCAC
CGGTAAAAAAAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62