GenePrediction:GLEAN_2819 Details

Name: GLEAN_2819
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3434612..3435455 (+ strand)
Length: 844
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3434612..3434635 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_140:3434724..3434762 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_140:3434954..3435028 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_140:3435090..3435455 (+ strand)
Length: 366
>GLEAN_2819 class=GenePrediction position=GCSC_140:3434612..3435455 (+ strand)
ATGGCTAGCGCTCCGACCAACAGTGTACGATTTTGCGATGCGCTTCTTTCTTTGACATTCGCTGTTCTGCCGCGTGCACC
AAGCTTGAAGGATACTAACTTCCCCTTTATAGCCCATCAAGCCGACGCGTCTTAAGCAGATCGCTGAAGATGTAAGCCAA
ACCCGTTCATTCCGCCCGCCACGCCCCCGTATGATGTTCTATAAGCGGATAGGAGAGGCGAAAAAAGGCGACAGAGAGAC
AAGAAGCAGAAGAAAAAGAAAAGAAAAGGGATACAGGACGAGTTGGGGGATGGGATCGGATGCCACAACGTTATAGGTTC
GAAGCTAACGCAAGGGATATAGGCTTGCCAGAGCGCGCTTGGCAGCGCCGAGTTCTACGAGCACGACAAGACGGAGCAGT
GGAATACGACGATTATCGTACGTGGTCGCAGCCGTAATCTAATAAGCGCTTTTTGCGACTGACCGGTGTTGCCAACAGAA
CTCGATCCTCAAGGCACTAATCGCCGAGTCGCCGTCGGGCGTGGCCGGCGCGCCGACGTACAAGTTTGCGGTCAACAGCA
CGATTGTGCAGCATCTGATCCCGACATCGCAACTGAACAAGTCGAGGGGGGCGGGAACGGGCTCGGTCGAGGACGCATCG
GCCGATGGTGAGCAGAAGAAGGTGACGCCGGACGCTACGAGCACAGACGGCAAGCCGCACGTGGGCCGGCGCGGGATGCA
CAGCGCGCAGGCAGCGTACTGGAACGAGAAGACGGACGGCATGTGGACATACAAATACGACGGCGGCGAGAGCAAGGGCC
TGGACGTGGTCGTGATGGTGCTGTGGGTGGCTTTTGACCGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62