GenePrediction:GLEAN_281 Details

Name: GLEAN_281
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:756953..759405 (+ strand)
Length: 2453
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:756953..757061 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_167:757134..758206 (+ strand)
Length: 1073
Type: CDS
Source: GLEAN
Position: GCSC_167:758269..759405 (+ strand)
Length: 1137
>GLEAN_281 class=GenePrediction position=GCSC_167:756953..759405 (+ strand)
ATGGGCGACGTGGCTAGTCCCCCTGTAGCTGGGGCTACGGGCGGCCAAGATGGCGCAGCAGAGGCCAGCTCGAGCAACAA
GTTTCAAGATGCGATCCTAGCATGGAGAAGTGAGTGATGGTCTGCGTTGTTCTGCGATGGCAGGACGAGAGCGGGTGCTG
ACTGACGGTTGCGATTTCAAGACATCGACCTGGCAGGTCTGGTTTCAAACCTAGACAACACGGCATCGGACATTGTGGCG
TACCAGCGCGACTCGACGGTGCAGAGGAAGGATCTGGCACAGAAGACAAAGGACTTTCGGAAACTGGACGATGCGGGCAA
GCTCGCGGACATTAAGGGACTCCTCAAAGCCTACCAGACATTCATCGATCTCCTTACGAACCACTCCAAGTCAGTCAACT
CGGCCTTCATCCAGGCGTACAATGCGCTGTCAGAGGCGCCAGACCCGTACCCACTGCTGGAGGCGTCGGTGGACTCGATG
CTGGTGGCAGAAGACACGCTGCCGAAGCTGACGGCGGAGAACGAGCACCTGCAACGGTCGGTGGCAGGACTGACGACACA
GCTGGAGTTGACGGAGTCGAAGCTGCAGACGGAGCGGACAGCACGGAAGCAGCTGGAGGACACGCTGGAGAGCCGGGTCA
AGGAGGTGGAACAGTCGTGGACGGCAATGGTGGCGGAGAAGCGGGAGAACTGGGAGGCCAAGGAGAAGACGTTTGAGGAC
AAGATCGAGAACCAAGAGCGGCTGCTGTTGGAGATCAAGGCCAGCTACGAGGTCAACCAGCGACTCGGCCACGCGGAAGG
AGCAGGGGGTGGGGGCGAGGGCGCAGGAGCAGGAGCGGGTGCGTACGTGACGAGCGCGGAACTGGAGATGGTACACGCAG
ATCTGGAGCGGACGAGCGGACGGCTGGCGGACGTGGAGGCGCGCAACGAGCAGCTGCTGGTGGACCTGGCACAGGCCAAG
TCGGCGCTGCCGGAGCAGGCGGTGCGGCTGGAGGACGACCCGGGATACCTGCAGGTGCTGTCACAGAACTCGTCGCTGGT
GCGGAAACTGGACGCCAGCCGAGTGGAGCGAGACGGGCTGAAACGTGGCCTGGATGGACGACTACGCGGGCTCGAGCGCG
AGGTGGCACTGCTGCGCGATGAGCGGGATGGGCTCAAGACCAAGGTGCAGCGGTGGAGCGACTACGAGGACGTGAAGCAG
GAGCTGGAGGTGCTGAAAAGCATCGAGTTTGCAACGGGCGAGGAGGAGGAGGGGGTCGGCAAGCCGGACGAGAACAAGGG
CGGGCAAAAGGCGACAAGAACGACACGCTCGAGCAGCTGCTGCTGGCGCGAAACAAGAAGCTGGGCGACGAGCTGACGAT
CCTGCGAGTGTCGCACCAGGACCTGCAGACGCGGCTGACGACGGTGGAGGGACAGTTGAGGCAACGGCAAGCGGACGTGG
AGCGGCTGCAGAAGCTGAACGAGAAGTTGGAGAATGACCTGGCGACGGTGGAAGCGGAGGCGACGAACCTGTTTCCATCG
GGCGCATCGGTGGCGGGAACCTATGTCAGCCGGTATGCAGCAGCGACAACATCAGGAGGTGGGGGTGGAGGAGGACGGCG
AGGGGCTTCGGGCAGCGGTGGGCGGTCGACATCGCCGACATCGTCAATCATCAGCGGGTTTGATTCGCGAGTTGGGGTCG
GCAGCGGACATCACGGACACCAGTTCTCGGGGCCGGACTCAGCGACGGGAGGCGGATCGGCGATGCTGCCAATGATCACA
GCGCAGCGAGACCGGTTCAAGAAGCGGATCGCACAGTTGGAGCAGGAGCTGGCGGACGAGCACCGAACAGTGTCCCATCT
GCGACAGGAGACGGCAGCGCTGCAGAAGGACAACCTGAATCTGTACGAGAAGACACGGTACATGTCGAGTTACCGGGGCG
GAGGAACGGCGATGACGTCGGCTTCGTCGGCGTCGGACTACGGCAACAACCCGAACCCGGCGACGGTGGCGATTGGCGGC
GGCGGCGTGTCGCTGGACCGCTACCGCAAGGCATACGAGAGCAACCTGTCACCGTTCCAGGCGTTCCGCGGACGCGAGTC
GGCGCGGGCATATCGACGGCTGTCGCTGCCGGAGCGCGTGGTCTACTCGGTGACGCGCATGGTGATGGCCAGCCGGACGA
GCCGCAACCTGTTTGCGGCCTATTGCGTGACCCTGCACCTGGTCGTCTTTCTGTCGCTGTACTGGCTTAGCAGCCTGGAC
GGGCAGACACACGCGAGCAACTTTGGGCACAGCGCGGCGATGGCGGCCGGCGGAGCTGTCGGTGGAGGAGCAGGCGGAGC
GGCCGGGGCTGTCGGGGCTGCCGGAGCTGTTGCGGGCAGTGGAGGCGGCAGCGGTGGCATTGCGGGCGGTGCAGCAGCTG
CTGCTGGCGGATCGTCACATGGACAGTGGCAGGAAGAAGGATTCAGTCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62