GenePrediction:GLEAN_2821 Details

Name: GLEAN_2821
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3438702..3440437 (+ strand)
Length: 1736
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3438702..3439198 (+ strand)
Length: 497
Type: CDS
Source: GLEAN
Position: GCSC_140:3439253..3439603 (+ strand)
Length: 351
Type: CDS
Source: GLEAN
Position: GCSC_140:3439679..3440099 (+ strand)
Length: 421
Type: CDS
Source: GLEAN
Position: GCSC_140:3440163..3440210 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_140:3440279..3440437 (+ strand)
Length: 159
>GLEAN_2821 class=GenePrediction position=GCSC_140:3438702..3440437 (+ strand)
ATGAGCTCTCCGGCCTCTTCACCGTCTGCGCTCGCCGCTGGCAGCAAGCGCAAGCGTGCCGGCGCCGAGCAGCCGCCGTC
GCCGTCGCGGGAGGACAGCCTCGATGAGCCTTCTCGGATCGAAGACGAGACCGAGCCGGCTGCTGCCCAAGATCACGACG
AGCCCAAAGACGACGAACCCGCGGCGACATCCCACAACCGTCGCAGCCATCGACATGGCGGCCACCACCACCACAGTCAC
AGCCACCAGACGACCGCCCAGCCGCTGCCGCCTAACAAGCGCCAGCGGTCCAACAACGGCACGGACGGCCGTCGGGCCCG
CAACGAGACCGATCCGAGCGACGACGACGACCAGGCCGAGGACGGCGACAAGACGTCGATGCTGCCGCCGCCCATTGGCA
AGCTGACCGACCCGGTCGGCTACAAGACCAATTTGCCCCCGGTCGGCCGTCCGGTGCGGGTATATGCCGACGGCGTCTTT
GACCTGTTCCATCTAGGGTATGTCTCTTTGGTCGTCTCTCTCCCGTCTTTTCTCCCGTCTAACACTTCTAGACACATGCG
CCAGCTCGAACAGGCCAAGAAGGCGTTCCCCGAAGTGTATCTCATGGTCGGCGTGACGGGCGACGAAGAAACACACAAGC
GCAAGGGTCTGACGGTGCTGTCGGGCAAGGAACGAGCAGAGACGCTGCGCCACTGCAAGTGGGTGGACGAGGTAGTGGAG
AACTGCCCGTGGATCGTGACGCCCGACTTCCTCGAGGCCCGGCAGATCGACTATGTGGCCCACGACGACATCCCGTACGG
CGCTGCCGAGGGCGACGACATCTACCAACCCATCAAGGCGGCCGGCAAGTTCCTTGTCACGCAGCGCACTGAGGGCGTCA
GCACGACGGGCATCATCACCAAGTAGGTCGGGCACAAGCTGCGGAGCAGGAAGCGGTACAGATGGATGACGTGCTGACAC
AGTTTCGTACTTTTCAGGATTGTCCGCGACTACGAAAAGTACATTGCGCGGCAGCTGAAGCGCGGCACATCGCGACAGGA
ACTTAACGTCAGCTGGCTCAAGAAGAATGAGCTGGAGCTGAAGCGCCACGTCCAGGACCTGCGCGACAATATTCGGGTCA
ACTGGACGACGACGGGCCAAGAGCTCAGCCGCGAGCTGCGCCAGTTGTGGCCGTCGAGTCGGCCGCAGAGCCCGGCGCCA
CGGCCGTCCCTACGGCTGGCATCGCCTTCGACGTCGACGCTGGCAGCAGGCAGCTCGATGGACCGGTCGCCGTCCAGCCC
GACGCCGACCATGGCCACTGCAGGCGGCGTGGCCACGCCCAAGTCGCCGGGTGCTGGTGGCACCAACGACTTTGTGGCAG
GTTATGCCTTGGGCCTGATTGGCGGTGTTCGCTCGTGGGTATGTGAGAGGGGAGAGAATGGAGAGACCGTAGGGGGAAGT
CCTGCTGACCAGACACATCAGATGACCAAGAGCCGTAGACAGGGCGGCCCCAACTCGCAGTCCCGACAGGTCAGCGATGA
CGAGTCGGAGGAGAATGAGGATGGCCACAACGGGGAATCCCCGACAACGACAACCAGGACAAGCGCGAGAGCCACGAGGA
CCACGAGAGCCATCCGGACGGCGGCAGCCACAACAGCCACAACCGCCATCACGGCCACGGCCGGAACGCCAAGGGTGGCA
ACAGCCGCGTGTCGTCGTCGTCGGACCTGCGGCGAGCCGTGCGGGCAGTCTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62