GenePrediction:GLEAN_2822 Details

Name: GLEAN_2822
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3471140..3472844 (+ strand)
Length: 1705
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3471140..3471183 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_140:3471325..3471346 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_140:3471402..3471432 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_140:3471513..3471522 (+ strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_140:3471579..3471662 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_140:3471737..3471843 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_140:3471906..3471981 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_140:3472049..3472299 (+ strand)
Length: 251
Type: CDS
Source: GLEAN
Position: GCSC_140:3472457..3472464 (+ strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_140:3472544..3472700 (+ strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_140:3472774..3472844 (+ strand)
Length: 71
>GLEAN_2822 class=GenePrediction position=GCSC_140:3471140..3472844 (+ strand)
ATGACTGAAAAGCCGCTTCCGTTCATATACCAGTTCGCCGCCGGGTATGCCACTCCCAGCTCCTCCTGACCCCAGCTGGC
TCTCGTGGCCATAGTGTCATCTGGACACTACCGTCTTGTGTGGTGTCTGCCTTCTTCGCCGATGCTTCAGAAGCCTACAT
TGCTGACATGGATATGAACCAAAAGTGCGGTCGCCGGCGTCTCTGAGGTCAGTGGATCTGAGCCAACAACTGACATCACG
CCCGTACTGACCCCATGTTTAGATTCTGGTCATGTACCCGCTGGATGTCGTCAGTACGTAGCTGCGACAGAACCCCCAAA
GCCACCCGAAACTTGGCCATGACTGTTGCTAACTGCATCTCCCCTCTAATCAGAGACTCGTGTGTAAGTTATTCAAGTGC
GCATGCTTCCGCTTCTGGTTGCCAAGCTCATAATCACAGGCAACTACAGACTGGCACGGCTACTGGCCCCGACTCGTACA
ACGGCATGCTGGACTGCTTCCGGAAGATCATTCGTCATGAAGGGTATGTCATACAGCCCCATAGACCGTCCCCCAACGCA
CAGTCGAAACCTGAGACTCACATCCAAATCTTTACAGCTTCTCGCGGCTATACCGTGGTATCTCCGCCCCCATTATGATG
GAGGCACCGAAGCGTGCCACCAAGTTCGCGGCCAATGATGAGTGGGGGAAGTTCTACCGCAACCGTATGTGCTGCCATGG
CGTCCTGAGTCAGCCTTGCGTCTTTATGGAGGCTAACGATGGTCAGTCTTCGGCGCTACACACATGACTCAGAGCCTGAG
CGTGCTGACCGGTGCTACCGCCGGTGCTACCGAGAGCTTCGTGTACGTGGAAACCCAATGGATTACGTAATCCATATCTC
TGGCTCGCAACTTTTGCTAACTCCCGCAGCGTCGTCCCCTTTGAGCTTGTCAAGATTCGCCTCCAGGACAAGGCGTCCAA
GTACACCGGAATGATCGACGTCGTCACCAAGACGGTGCGCAACGAGGGCGTCCTGGCCATGTACCAGGGCCTAGAGAGCA
CGCTCTGGCGCCACATTCTCTGGAACGCTGGCTACTTTGGCTGCATCTTCCAGGTTCGCCAGCTGCTGCCCAAGGCCGAG
ACCAAGCAGGGCCAGATGGTGACCGACATCACCGCCGGCAGTACGTGTCCCACTCCGTAAGCCTTGTATTTTGCCTTCAT
TATTACTGACCCCCCTTGTTCAGCTATCGGCGGAACTGTCGGCACAATTATCAACACGCCCATGTGAGTTTCACCCCTAG
TTCTCTCGTGCTGACCGCAATGGCTAATATCGTTCAGGGATGTCCGTACATGACCAGAGTCTTGCTCGCTCTAGGCTCAC
CCCTTTGCTCCCCCCATTGTTCTCGTACTAATCGTTTTCTGCAGGTTGTCAAGAGCCGTATTCAGAATGCCACACGGGCG
GCCGGCGTGACCCCCAAGTACAACTGGGCCTGGCCATCTGTCGGTCTGGTCCTTAAGGAGGAGGGCTTCGGTGCCTTGTA
CAAGGGTTTCCTGCCCAAGGTTTTGCGTCTGGGCCCTGGAGGTATGCATCAACTATCTAGCTGAGATCCGAACCCGCCTC
GTCCTACTCTGACCTTCTGCTAATAAAATAACAGGTGGCATCCTCCTGGTCGTGTTCCAGGGCACTATGGACTTCTTCCG
CAAGATGCGCGAGTCAAGTGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62