GenePrediction:GLEAN_2824 Details

Name: GLEAN_2824
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3482290..3483660 (+ strand)
Length: 1371
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3482290..3482527 (+ strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_140:3482583..3482673 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_140:3482740..3483472 (+ strand)
Length: 733
Type: CDS
Source: GLEAN
Position: GCSC_140:3483529..3483660 (+ strand)
Length: 132
>GLEAN_2824 class=GenePrediction position=GCSC_140:3482290..3483660 (+ strand)
ATGCTGTCCAAGAGCGTTGTCGCCCTGTCCTGCTTGGCTGCTGTGGCTTCTGCCCACGGCGACCACAACCAGCAGAAGAA
CGTTGCCGGCCCGCTTGAGTCGCTTTGGTACAACACTCTGCCGGGCGATGGTGGCACCCAGGCCGACTCCGTCTTTTCTG
GCATTTCTACCTTTGGTCGTCTGCCATACCAGCCGTGTCTGGCTAACAAGAATGTCAACTATGACATTGCCTTTATCGGT
TCGTGCACTGGCCCTCTCAGACTGCCTCTGCTTCTTCCATGCTGACTGGCCAGGTGCCCCCTTTGACACCGGCACGTCGT
ACCGGCCTGGTGCCCGTTTTGGTCCGTCTGGTATCCGCCAGGGCTCTCGTCGTCTGAACCTCTAGTATGCGCTTGTGCCT
GGCTCTCTCTCTCTTTCTCTCTCTCTCTCTCAAGAGCTGACCAAAAACAGCGGAGGATACAACGTGCCCCTGCAGACGAA
CCCGTTCAACAGCTGGGCCACCGTTCTCGACTGTGGTGACATCCCGGTGACCTCGTACGACAACACGTACGCGCTCTACC
AGATCGAGGAGGGCCACAATGCCATCCTCTCACGGGCGCCGGCCACGGACGCCAGCGAGGTTGGCCCGGCACTGGGCGGC
CGCACGCTGCCGCGTGTGATCACGCTCGGAGGCGACCACACGATCACGCTGCCGCTGCTGCGGTCCATCAACCGGGCCTA
TGGCCCCGTGTCCGTGATCCATTTCGACTCGCACTTGGACACGTGGAAGCCCAAGGTCTTTGGCGGCTCGCCCTCGCACG
TCGCCAGCATCAACCACGGCACGTACTTTTACCATGCCGCCCAGGAGGGTCTGCTGCGCAACGACTCCAACATCCATGCC
GGCATCCGCACCACGCTCAGCGGCCCGAGCGACTACGAGAACGACGGGTACTGCGGCTTCGAGATCGTCGAGGCCCGCGA
GATCGACACCATCGGCACTGACGGCATCATCGAGCGCATCAAGGCCCGCGTCGGCACCAAGAACCCCGTCTACCTCTCGC
TCGACATCGATACGCTCGACCCGGCCTTTGCGCCTGCTACCGGCACCCCCGAGACTGGCGGCTGGTCCACCCGTGAGCTG
CGCACCATCCTGCGCGGCCTCGAGGGCATCAACTTGATCGCTGCCGACGTCGTTGAAGTGGCCGTGAGTGCTTCCTTGTT
CCTGGCCATCCTCTCTCTCCTTGTACTGACAAAGTGTAGCCCGCTTATGACACCAACGCTGAGCACACCACCATGGCTGC
TGCTGATGCCATTTACGAGATCATGAGCCTCATGGTCAAGCACGGCTCGCTCAGCATTGAGAATGAGAAGGCGTCCGATA
ACGAATTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62