GenePrediction:GLEAN_2826 Details

Name: GLEAN_2826
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3489037..3490602 (+ strand)
Length: 1566
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3489037..3489169 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_140:3489233..3490602 (+ strand)
Length: 1370
>GLEAN_2826 class=GenePrediction position=GCSC_140:3489037..3490602 (+ strand)
ATGGCCCGTCTTGCAGCGATTGCCAAGGGCGTGCCAGTGCTGGCAGCGCTCGCACATGCGGTCAACTATCCGGCTAAGCC
AGCCGACCTGACGACGCCGGTGCAGCAGCGGATTGCGGTGAACGGGGCAAGCTGTACGTGATGACGGGATGAGTGCGAGG
AGAGGAAAGAAAGAGATGTTGATGCTGACTAAGCAGCCATATCGGTGGGCTGGAACACGTACGAGACGCTGTCGCAGGCG
TGTGTGCAGTACGGACTGGCAGCAGATGCGCTGACGCTGGAGGCGTGCTCGAACACGTCGACGACATATGCGACGTCGCG
GACGTACTCGCACGCGGTATCGTTGCCGAACCTTAAGACCGCGACGACATACTACTACAAGATTGTGTCGACCAACTCAA
CGGTCGAGCAGTTCATGAGTCCGCGGCAGGCCGGCGACACAACGCCCTTTACGATGAGCGTGGTGATCGACCTGGGCGTC
TATGGCAAGGACGGCTTCACGATCGCGATGGACCACACAAAGCGCGACCTGATCCCGCTGGTCGACCCGTCGCTCAACCA
CACGACCATCGGCCGGCTCTCGGCCACGGCCGACGACTACGAGTTTGTCCTGCACCCGGGCGACTTTGCCTACGCCGACG
ACTGGTTCTACAACGTCGAGAACCTGCTGGTGGGCGAGGCTGCCTACGAGGCCATCCTCGAGGAGTTCTACGGCCAGTTG
GCCCCCGTGGCTGCTCGCAAGCCATATCAGGCCTCGCCGGGCAACCATGAAGCAGACTGCGAGGAGCTGCCGTACACGGC
CGCCCTCTGTCCGGCCGGCCAGAAGAACTTTACCGACTTCAACAATCGCTTCGGCCGCTCGATGCCCACGGCCTTTGCGT
CCACCTCGACCAATGCGACGGCCCGCGTGCTGGCCAACAAAGCCCAGCAGCTCGCTCGGCCGCCCTTTTGGTACTCGTTT
GAATACGGTATGGTGCACGTGATCATGATCGACACCGAGACCGATTTTGCCAACGCGCCCGACGGCCCCGACGGCAATGC
TAACCTCAATACTGGCCCGTTTGGTGCTGACGGCCAGCAGCTCGCCTTCCTTGAGGCCGATCTCGCCAGCGTCGACCGCT
CCGTTACGCCCTGGGTCATCGTCGGTGGCCATCGGCCGTGGTACTCTACCGGCGGCTCCGACAACATCTGCACGGCCTGC
CAGACTGCTTTTGAGCCGCTCTTCTACCGCTACGGCGTCGATCTCGGCATCTTCGGCCACGTCCACAACTCCCAGCGCTT
TCTGCCCATCAACAACAGCATCGCCGATGCTAACGGCCTCAACGACCCCAAGGCCCCGGCCTACATTATCGCCGGTGGCG
CCGGCAATGTCGAGGGCCTCAGTTCCGTTGGCGATAATGCCACTGCCAACGTCTTCGCCTACGCCGACGGTTTCAGCTAT
GCCACCGTCTCCTTTGTCGACGCCTACAACCTCAAGGTCGACTTCTTCCGCTCGTCCAACGGCGAGCTGCTCGACTCGTC
TGTGCTGTACAAGTCGCACACGGAGCAGTTTGTGGACCAACAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62