GenePrediction:GLEAN_2827 Details

Name: GLEAN_2827
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3491904..3494068 (+ strand)
Length: 2165
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3491904..3491930 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_140:3492010..3492058 (+ strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_140:3492129..3494068 (+ strand)
Length: 1940
>GLEAN_2827 class=GenePrediction position=GCSC_140:3491904..3494068 (+ strand)
ATGACGAGCATTGACGAGCTCTTCAAGGTGAGATTGCCGACCAATTCATTTCTTGTCGACGTCTTGGCCATGCCACGCAG
GCAGCTGACACAGCTTCTGGCCCCAGAAATCCGGCATCCCCAGCAAGCGCAAATTGGAGCCTCTCCGCGACCCAAGTCAG
TTGCGCTGTCTCTTCTCGGTCTTGGTCGCCACAAGCTGACCATTCCTTCTTCTTTGCGAGCACAGATGAAATATACAAGG
CCGTGAGGCTCTCTGGAAACGGCAGCCACAACCGCAACGGCAACGAGCGCCACGTGCAGATCGACGAAAACGACCAAGAC
GAGGCCGGACCAGCACGACCACCAGCTGACGGCGACGATGGAGACTACGGCCCGGCAGCACCACCAGAGGGCGATGATGA
GCCAGGCGACGACGACGAGGGCCGGTTCTTTGGCAGTGGCATGAGCCGGACCGAGGCCACCATCATGGACTACGTCGAGG
GCCAAGATGCCGGTGGAGGCTCTGGGGGAAAGGAGGTGGCCGAACAGCCGCCGCCACCAGAGACATATGACGCGGCGTGG
CTGCGGCGAACGGTTCTCAGCTTTGAGCGGCGCATCAACCGAAACGCTGAGCTGAGGGCGCGGTACGAGGCTGAGCCGGC
CAAGTTCATCGCCAGCGAGGCCGAGCTGGACGTGGAGATCAAGGCGCTGTCGATCCTGGGCGAGCACCCGGAGCTGTATC
CCGAGTTTGTGCGGCTCGGCAGTGTGGCTAGCCTCGTCGGTCTGCTAGCTCACGAGAACACCGACATTGCCATCTCGGCC
ATTGAGATCATCGGCGAGCTGACGGACGAGGACGTCGACGCGACAGACGAGCAGTGGAATGCACTCGTGGCTGACCTGCT
GGACGCCGACCTCATTGGCCTGCTGGTGTCCAACCTCGACCGACTCGGCGAAGACGCCGACGAGGCTGACCGCACGGGCG
TCTACTACGCGATGGGCATCGTCGAGAATCTGTCTTCAACGCGAGGCGGTCTTGGCGAGGAGGACGAGGACGAGGACGAG
GAGGGAGAAGAAGGAGAGGTAGGAGAAGTGGAAAAGGATGGCGAGACAGCTACGAAGAGCAAAAGAACACGCGCAGCCGC
TGCCTTGGGCGCCCACGAAGGCCTCGTGCGCTGGCTGCTGAAGCGGGTGCAGCGGGTATCTTCGAAGGCGGGAGTGCCGG
CAGTGACGCAAAACAGGCAGTACGCAGCCGAGGTACTGGCAATCCTGGCACAAGCAGAACCAGAGAACCGACAGCGGCTG
GTGGCACAGGACGCAGTGGACACGCTGCTGCAGCTGGTAGCAGCATACCGACGACGCGACCCGGAAAAGGGCAGCGACGA
GGAGGAGTACATGGAGAATTTATTCGAGGCATTGACCTGTCTGGTCGACGATGCTGGCGGCAAGCAGAAGTTTGTCGATG
CCGAGGGCGTCGAGCTGTGTCTGCTGCTATTTGCGGCGGGCCACAAGAAGAGCCTGACGCCGGCACTACGGCTGCTGGAC
CACGCTGCTGGTGTTGGCGATGGAGACGGGGCGACGGCCGAGGCAGCAGCCGATGTTTGCCGACGTATCATCGACGCGGG
CGGGCTTAAGGCCATCTTCACCCTCTTCATGCGCGGAGAAGGACACCACAGCAAGAAGCACGGAAAGAACAGGAAGAAGG
CCTTGGCAGAGCAGACGCTGCACGGGGGCCTTACGGCTGAGCACCTGGTCAACATCTTTGCGTCGATGCTGCGGCTGCTG
GCGGCGGAGTCAGCTGAGCGAATCCGGCTGCTAGCCAAGTTTGTCGAGAAGGACTACGCCAAGGTCGAGCGACTGTTGAG
CCTGCGACAAGAGTACAGCGACCGCGTGACCGCAGCCGAGCAGCGATTTGGGGATGGCAATGGAGATGAGGCCGAGAGGC
TGGCGCAGAGACTGGACGCCGGTCTGTTCACGCGCCAGACGATAGACGTGATCCTGGCCTGGCTGGTGGCCGAGGACGAC
GGGGCACAACGCAAGATTTGTGTACTGCTGGCCGACCGCGACGAGACTCTGGCCACGCTGCGGCTGTCGTTGCAGGAGAG
GCGTGACGGCATCGATCCCGACGTGGCCGACGGCCGGGACACACAGGAGATGCTGACCACGCTGATGGGCTTTTTGGAGG
GGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62