GenePrediction:GLEAN_2832 Details

Name: GLEAN_2832
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3543767..3545390 (+ strand)
Length: 1624
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3543767..3543850 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_140:3544049..3544357 (+ strand)
Length: 309
Type: CDS
Source: GLEAN
Position: GCSC_140:3544437..3545150 (+ strand)
Length: 714
Type: CDS
Source: GLEAN
Position: GCSC_140:3545214..3545390 (+ strand)
Length: 177
>GLEAN_2832 class=GenePrediction position=GCSC_140:3543767..3545390 (+ strand)
ATGGCGCTGCTCGATGCTGCTCCGCAGACTTCTTCGGGACCGACTTTATTTGGCGTGCCCATGAAGCAGGTCTCTTTGAT
CACGGTAAGCTGATTTGATCGTCCCCGTTGTACTTCCCCAGAAGCTCCTGTCTCTTCTCTAGGTGCCCATCAATTGATTC
CTGCTAATCGGTACTCCCACTCGCAGCTCACTTTTCAAAATTCCGCCCTCACACTCGTACGATCTGGCCGTCCTCCCCCC
TCCGACGGATGGCCTTGGGCAAGCAATGCTGACCAGAGCCAGATACTCCACTACTCCAGGATAATGCCCGCACCCGGCGA
CCACCGCTACTTTGCCTCGACTGCCGTCTTTCTAAACGAAGTGCTAAAGCTCGCCATATCCCTGACTTTTGCCATATATG
AAGTCTCGCGAACTCTCGCTCCACAAACCCCCGCAAGCGTTGTGCTCGAACAGATCTACAATTCCGTCTTTTCGGGCGAC
AGCTGGAAACTGGCGATCCCGGCAACACTGTACATCCTGCAAAACACCCTGCAATATGTGGCTCTCGGAAATCTGGACCC
AGTCCATTTCCAAGTTCTCTATCAGCTCAAGGTGCGCTAACGTCCTTCCGCTCTGATCTTCCAATTGAAGATCTCAAATG
TGCTGACGGCTTGTTTGTTGCTGTCCACAGATTATTGCCACTGCATTCTTCAGCGTCGTCATGTTGCAGCGCTCATTGAC
GACCAAACGATGGATCTCGCTTATCCTTTTGACCATCGGGGTCTCCGTCGGCTCTCTACCCTCTCCCGACTCCAAAGATG
CAACTATCATGATTCACGACTTCAGCGACCACTTTTTTCCGCGCTCCATGCACGAGCTGGGGCAGATGACAGGCAGTGTT
GGCGATGTGGCCCGTGAGCTGACAAAGAGGGCTGTCGGTGGCGCAGTGGGCGGGCTCATGGCGCGCTCAGCCTCTTACCA
GGGCATCGACGATGATGAGGATACGCACCCGAAAATGGTCCGTTCCGTCGGCGTCACAGCGGTTCTTGTGGCCGTGACGG
TATCAGGACTGACAAGCGTCTACTTTGAAAAGGTCTTAAAGGACACGAACGCACCCGTCTCCATCTGGACCCGGAATATC
CAGCTGTCTTTCTATTCCCTGTTCCCTGCTCTTTTCATTGGCATCCTCTACAAGGATGGGGAGGAAATAGTCCAACACGG
CTTCTTTGATGGCTACAACTGGATCGTCTGGACCGTCATCATCTTCCAGGCTGCTGGCGGGATCCTCACTTCTCTGTGCA
TCAACTACGCCGACAATATCGCCAAAAATTTTGCCACCAGTATCAGTTTCGTCATTAGCTTTCTGTTTAGCATCTGGTTC
TTCGAATTGCATGTCACTTCTTCTGTATGTTTGTTGTCTCCCATTGCTGATCACCTCGTCGAAGCAGTACACTGACTGAA
CTTCCAGTTTTTGATTGGCACGTCACTCGTGCTCGTATCCACATACCTTTACACGGGCCCTGATCGGAGACGAGGACGGC
CACCACCTATCACAATTGTCAACTACGAGAAAACTACCGTCGTGGATACCCCAAATTACACCGACGAGGCAAAGTTGTCT
CCTGACCTGCTGGCAACCGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62