GenePrediction:GLEAN_2833 Details

Name: GLEAN_2833
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3546903..3550170 (+ strand)
Length: 3268
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3546903..3548143 (+ strand)
Length: 1241
Type: CDS
Source: GLEAN
Position: GCSC_140:3548202..3550170 (+ strand)
Length: 1969
>GLEAN_2833 class=GenePrediction position=GCSC_140:3546903..3550170 (+ strand)
ATGCAGTCGTCATGTTTCTCCAATGTCTATGGATCGAATTACAACGTGGTTGTTTCTGCGCCAACAGGCAGTGGTAAGAC
AGTCATATTCGAACTGGCCATTTGCAAGTTGGCGGCACAAAAACGGAAAAATGACTACAAGATAGTCTACCAAGCCCCTA
CAAAGGCACTCTGCTCCGAACGAGCACGCGACTGGCAAGCCAAGTTTAGAAAAATTGGTCTGCAGGTTGCCGAGTTCACA
GGAGATACCTCCGCATTCGAGGCTCGGAGAGTTCGAACCGCTTCAATTATCATCACGACCCCGGAGAAATGGGATGCGGT
CACACGGAAATGGGCTGATTACGGGATTCTTCTGAAAAGTGTGAAGCTTGTTCTTATTGACGAAGTGCACATCCTAAAGG
ACGTTCGTGGTGCCACGCTCGAAACTGTCATTTCGCGGATGAAATCTCTTGGAGTTGAAGTGCGATTCGTGGCCCTCAGC
GCTACGATCCCCAACTCCAACGATATTGCGCAATGGCTCGGTCTCAATCACACAAGCCCACAGATTCCGGCTAAAAAATT
TGTGTTTGGTGACGAGTACCGCCCAGTACGACTCGAAAAGATCGTTCATGGCTACGTCTTGAGCGGCAATGACCATTCAT
TTGACAGCGTACTGGACAACCAGCTTCCAAAAATTATCACACGATACTCCCAGAAAAAGCCGGTGCTCGTGTTTTGCTTC
ACACGGAAGTCGTGTGAGAGTGCCGCTTTGATTCTGGCCGACTACTGGGACATGTGCTCTTCCGAAAGCAAGCCGTGGCT
AGCCAAGCCTGCGGAAATATGTGGAAGCGCAAGGCTCCAAGTCTTCCTGTCGCGCGGAGTCGCTTACCATCACGGAGGGA
TGGAACGACAAGACAGAGCCAGTGTAGAAGATGCGTTCCTGCGAGGACATCTCAGTATAATCTGCTGCACATCGACTTTG
GCAGTTGGAATTAATCTACCATGCCACACAGTCATACTTAAAGGAACTATGGGGTACCACAACGGAAAGTTGGCTGAGTA
CGACGAATTCGAGATTATGCAGATGATCGGACGGGCAGGTCGACCCCAGTTCGATACCAGCGCTATCGCAATCATCCTCA
CTCGGGCTGAAACACAGGATAAGTATAAAGAGATTAGCTCCGGCAGCCAAGCCATTGAAAGCACATTAAATCTCAATCTC
ATCGAACATCTCAACTCGGAGACGGTTCTGGGAACGATTTCGTCACTTGAAACAGCCGTGCAGTGGCTGGAAGGGACCTT
TATGGCTGTTTCGTGTCAGAAAGAATCCGAGTCACTACCAGATCCCCGGATTCAACTCCCGTGCGCTCAACCCCGATGAA
CAGTTTCGGGAGATATGCAAGGATGCCATTGACCAGCTTGCTCAAGCAGGGCTGATCAAATATGTGGACGACGATGCAAC
GACTTTTCACGCAACAGACTACGGCCGTGCCATGTCTACTTTCATGGTGAAACTCGACACAATGCGCATGATTCTCAACA
TGGAAAAGCATGTTGATATGGAGAAGTTGGTGAGCACAACTGAGAGTCGCCTCGAGACTTGGGGCATTTGCACTGACCAT
AAAAAGCTGAACACGATGTGTCGTGCAACTGAATTTGACGAGTTCAGGATCAAGAGCGCCGAGCGGCCAATACTGCGAGA
GCTGAACAAGACTCATGATATACCGTTCAAATTCAAAGAAAGCATCACAGAAACTTGGCAAAAGATATCTGTGCTGATTC
AGGCCGAGCTTTCACGCGGGGCTCTGCCACACCAGCAACGAATTGCTATCGAGGCAAAGCAGGCCTCTGAGTGCTTACAG
AGGCTTTTAGAAAGTTATTCTCTATGCAAAATTGCTAATAGTGATTCTCGTGGGCTAAAAGTCTCTTTGGAACTTACAAG
AAGTCTTTCTGCGAGGGCGTGGGAAGGACACCATACCCAGCTCTGTCAAGTGCCAGACATTGGCCCTGCGAATATGACTA
AACTAGTGGACAAGCATATATTTACGGTATCGGATTTTTCCGATCTTACTTCCGTCCAAATCGAGAGTTTTCTTTCCAAA
AATCCGACAACAGCTTTAAAAATATCTGATGCTCTAAAGTGCTTCCCGCGTCTACGTCTGGAAGGTCATATTCTAAGGCA
TCAAAGCCGCAGTTCTGACGAGACGCCTGAACCGAATGCCATTGCCAAAGTGACATTCGGCCACATGAACGAGATGGGCA
TACCGCGCTGGAAAAACAAAGTACCATCGGTGACATTTTTCGCCGAGTCGGGGGACGGGAAGCTGCTACATATATGGCGG
GGAAAGCTACAAGAGAAGACGCACCCAACCTCATTTTTAGTCCCCGCAAAGGATTTAGGAAACGTTACTTGCCATATAGC
CTGTGATGAAGTGGTTGGAACGATGCAGTCAGAGCAGCTTTCTTGTCTGGAAGGGACGTCTGATGATCTAGAGCTGATGG
CAGTACCAAACAGCGTAAAACTTTCAGAGAAGGTGAAGTTAAGAAAACTGCCACAGGCCGAAGGACTCGAGAGTGCACCC
AAACGCCAAAAATGGAACACGACATACAAGGTGTCTTCCGTTGTCGTTGGGGACAGGGAATTTGCTTGCATTGACCTGTC
GTCTGTGGAAGAGGGTACCACCACTCAGGAGATCTACAAGTCCCCACCTCCAATAATGCCACGGAAATGCGAGAGGGAAG
ACAACAGTTCGTTAATGTCATCTGTTTTGTGGAGCAGCAGTGTCCGTACAACAATGTTTGGGGACACGTTTGGTGATGGA
ACGTCGCTAAACCCCTGGACAGTGGCCGGTTCTGAGACGACGGATGATTTTGACACGGATATTTTTGACGACATGGAGCC
GCCGGCTGTGGAAACCTCGATGGCAGGTGTTGAGGGAAAGTCTCAAAGTGGATTGTATAAGACCGGGCAGGAAAAATTCA
ACACTGAGACAGGGCTCAGTAACGCGATGGTGCAAAAGGACAATTACGTGGAGGAGGGCCCAGCTGCTAACGCAAAAAAG
GCGAATGGTCCGGATACTGCGAATACAATAGAAACTGGGGGTGTTGATGCGCCACAGACAGGTTCGCTGCAGCAACTTGT
CGTTGGACAGGATAATATTGTTACCCCGAGAGAGGGCTTGGCAGAGAAAGCCACCGATATACAGAAAGATACATCCGAGC
CAGCTTGGGTTGATTCCTCTGATAGGGATGTGATTGATTTCTTGCGAGGACACGTTAAGTTTGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62