GenePrediction:GLEAN_2834 Details

Name: GLEAN_2834
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3581226..3582853 (+ strand)
Length: 1628
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3581226..3581727 (+ strand)
Length: 502
Type: CDS
Source: GLEAN
Position: GCSC_140:3581801..3582299 (+ strand)
Length: 499
Type: CDS
Source: GLEAN
Position: GCSC_140:3582382..3582853 (+ strand)
Length: 472
>GLEAN_2834 class=GenePrediction position=GCSC_140:3581226..3582853 (+ strand)
ATGTCTGGCTTCCTCTGGTGTATACTCGTGCCTGTGTTGTCGGCTGTCGCTGTTTCTGCACATATAACGACGTGTCAGGT
CGTCGATGCCATGATTCCTGGGCGTGTCATCTTTTCGAACGACACCATATACACTTCCACCCAGTCGTCGTACTATAGCG
GCGAAGAGCGCGACCTCACCCCCGACTGCATCTTTATGCCAACCACCGCCTCTGAGGTCAGCCAATTTGTAAAGACTGTC
GGTGTGCGCAAAGGAAAGGATGCTCTGTTTGCCATCCGCGGGGGTGGCCACACTCTCTGGAGTGGTGCCGCGAACATTGA
AGGTGGTATCACGGTCGACATGCGTCTTATAAACCAGACGGTACTGAGCGCAGATGGAAAGATCGCCAGTCTTGGAGCTG
GTGCCAGGTGGCGTGACGTCTATCCTCAGCTCACGCCGCACAACGTCACTGTTATGGGGGGCCGGCTTGGAAGCCTTGGT
GTAGGGGGCTTTCTTAGTGGCGGTAAGTCTGGAGAACATCACAAGATCTCATTGTACGAAACTCTCTGATTAGCTAATAC
CTTTTTTCGTACAAGGTGGCCTAACCTTCCTGTCCCGCAGACAAGGTTTTGCCTGTGATAACATCTACGGCTACGAGATC
GTTCTCGCTAGTGGGGAGGTTACCTACGTGACCGAAGCTTCCCATGCTGGCCTCTGGCTGGCTCTTAAGGGCGGATCCAA
TAACTTTGGCATCATCACGCGTTTCGACGTGTTAACCTTTCCTTCAAACCGCATGTGGTATAGTCTTCTTCAGTACGAGT
ATAACAATACCGTGTTGGAGGCCCAAGCCCAAGCCTTTAGTCGCTTCATGGAGCCGGCCAATTTCGATTCCGCTGCCATG
ATGGGCATATTTATTGATTACGTCGGTGGGGCCTATTCTATTACAGACGCCCTGTGGTACGCAGACGACGTCGTCATGCC
TCCCGTCTACAACGGCTTTACAGAGATTCCCAACATGGGCGGTGTTGCGGAGCTTGCCACTGTTGCCGATGTTGTGGATA
CATTTGGAGCTAACATCCCAACCGCAACCTCACGGTAAGTAAATAGACTACCTACGTATCTTGTGCCTGGCTTCACAAAT
GAGACTCTGCTGACTCCATTTTCTCCGGCATTCTAGCGCCTTCCAACTCGATTGGTCGTTTCAAAACCCCCCTGCTGAGG
TCTATATGGAGCTTTTTCAGATCTGGGAGAAGGGCATCAGCACAATAGCCGACGTGGAAGGGCTCTTTATCGAGTTCTTG
ACGCAACCGCAATCGGTGACCAATGGCAAAAACCTTTTCGGTCTAGTGACGGGCAAGACCAATTACGTCGTGGGGCTTTT
GACAGCGGCGTACAGTAACGCATCCGACGATGTGAAGGTCCAGGTTGCCATTACCAACATCGTGCAGGCGCAGAAAAAAG
TTCTTAGGCACGGCAGCTACCTGATTGATTTCGTCTACACGAACTATGCCGATGGTTCCCAGGGTGTGTACCAGAGTTGG
GGTGCCGAAAATGTCGCTAAGCTTCAGGCTGTGAGCAAGGAATATGACCCTGAAGGAATATTTCAGACGAGGGTTCCTGG
TGGCTTTAAAGTTTTAAAGAAAAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62