GenePrediction:GLEAN_2835 Details

Name: GLEAN_2835
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3591260..3596979 (+ strand)
Length: 5720
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3591260..3591360 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_140:3591656..3591962 (+ strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_140:3592026..3592610 (+ strand)
Length: 585
Type: CDS
Source: GLEAN
Position: GCSC_140:3592673..3593035 (+ strand)
Length: 363
Type: CDS
Source: GLEAN
Position: GCSC_140:3593166..3595565 (+ strand)
Length: 2400
Type: CDS
Source: GLEAN
Position: GCSC_140:3595642..3596979 (+ strand)
Length: 1338
>GLEAN_2835 class=GenePrediction position=GCSC_140:3591260..3596979 (+ strand)
ATGACGCTGGCTTCTCAGTGGGAAAAGTTGCGTAACGGTCCACTGGGTGGTGCGTGGGAGGGTGCTTTCGTCTGCATCTA
CGCCCTGGCCATGTTCATTGGGTTTGTCCCTCTTTTGTGTATGCTGTGAATGCATCGCACACTCAGCTAACCAATATATG
GCCGCAAGACACCATGAAGCGCGTGATGTCCCATACCATGTCGCGACTAGGAAGAATGATGGAGCAACTTGTTTGGCAGG
CATCAGCATTGGCCTTTTCTCGGCTGCATCAGTGGCTGTGTCCCCGTCTCTTGCAGATCTTGCCTCACATGGAGCCGAAA
GCGTGCGAGTTGCTTTTGTCTTTTGTCGTCATGTCGGGGTTGTTTCCCAGCTTCTTGAGAACACCCATCAAGCCAGAGAT
ACGACAGCTCTGTCTAAAACCACCTGGGCATCTGTGATCACTGGCTTGCCAGCTGAAGTGGTGCAAGCCGAACTAGATCG
CTTCCATGGCCAACAGGACGTTGATGGTGAGAAGGGCATGACGACGGCACTGACCCAAATCAGCATCAGTCACGTGGACC
ACGCTTCGGTGGGCATCACTGGTCCTCCAGCTCACCTCACCCAGCTCTTTCGACAATCAAAGACCCTCGGCTCCTCTCGA
CACGCCGCACTGCCAATCTCGGGCGGTCTCTGTCACGTTCCCAATGTGTACGATGCCGAAGACGTACGTGCCATCATGAA
AGAGGCATGTGTCTGGGAGAGATGGGGCTGCTGTTCATTTCATCAGCCTCTGCTTTCTCCATATACGGGGACCGCCTTTC
CGGCCAAGGATGCTTGCCATTTGATCGAGGCTATATGCACCGAAGCTCTTACCAAGCCACTGTTCTTTGACAAGCTCACT
GAGGGAGCAGTAGCACATATTTTGCCTGAGCTCAATATTCACGCGGAGCCATCGTGCCAGATACTTCATTACCGAACATC
CCTCCTTCCAGATACCATCATATCGGCTGTCGTGGAAAATCTTCCGCCTTCTACTGTCGTGCAACGTCAAGACCTCGTCG
ACTGGGCGATGCAAGATGAATCTGTGACCGATCAACATTGTGGGAACCCAGGCCTGCCACAAGATTCTAAGCTGGCAATC
GTTGGCATGGCATGTCGTATGCCGGGGGACGCTGATACACCTGAGCAATTCTGGCAGCTTCTAGTCGAGGGCCGTGATAC
CCACACTCGAGTGCCCCCGGATAGGTTTGATCTCCAGGCGCATTTCGACCCGAGTGGAGAGACGGAGAACGCTGTGGGGA
CACAGTTTGGCAACTTCATATCAAATCCCGGACACTTTGATGCCGGCTTCTTCAACATGTCCCCTCGTGAGGTAAGGACA
CTAATAGACTCCTGGGTTGCCCAAGGCTCTGACCATGAACCTGTGTGCAATAGGCCCAACAAACAGATCCCATGCAACGT
CTAGCACTCGTGACAGCTTACGAAGCGCTGGAGATGGCCGGTTTCGTTCCCAATCGGACGCCATCCTCTCATACCTCGCG
AGTCGGGACCTACTATGGCCAGGCTAGCGATGACTACCGCGAGGTGAATGCAAGCCAGAAGATTGGCACATATGGGATTC
CCGGTACCGAGAGGGCCTTCGGCAACGGTCGGATCAACTATTTTTTCAACTTCCAAGGACCGAGTTTGAACATCGACACA
GCTTGCTCGAGCGGCTTGGCAGCAGTCCACACGGCCTGTTCGGCACTATGGGCTGGTGATGCGGATACTGTGGTGGCCGG
CGGCCTAAATATCATCGTGAGTCTAGGTCATGATTGAAGAATCGCAGATTGTGGCCAATTTCAAACGCAGTGCTGACCTG
GGAGCTTGGCATCAGACGAGTCCAGACATCTATTGCATGCTAGGCAAGGGACATTTTCTGTCCCAGACAGGCCAGTGCAA
AGTATGGGACGCTGCCGCCGATGGCTACTGTCGTGGAGATGGCGTTGGTTCCGTCGTTATCAAGCGGCTCGAGGACGCCT
TGGCGGACAATGACGTTGTTCTCGGTACTATTGTAGCCGGTGCTACGAATCACTCATCTGACAGCGTTTCCATTACTCAG
CCACATGCTGGTGCTCAGATGGACAACTACCGTCAGGTGCTGGACAAGGCAGGTGTCAAGGCTCTTGACGTCAGCTTTGT
AGAACTTCACGGGACCGGGACTCAAGTAGGGGATGCAGTCGAATCGGAGTCGGTACTCGGTTTCTTTGCACCTCTAGGCC
AACGCCAGCACCCCGAGCAACGTCTTCACCTGGGTGCCGTCAAGTCCAACATTGGACATGGCGAAGCTGCTGCGGGTATT
GCTTCTTTGATCAAAGTGCTTCTGATGTACCGCCACGGGATTATTCCACGCCACATCGGGATTCAGACGATGCTGAACCC
CGTTGTGGCCCAGCATTTGGCCCATCGAAATGCCAATGTTCTCTCCGAAAATACTCCCTGGGTGTTTAAAACAGATGCCA
GTGGTGGCGCGAAGAAACGGTATTCCATCGTAAACAGCTTTGGCGCCCACGGCGGCAACACGACGCTCCTTCTCGAAGAT
GCACCGCCATCGACACCAGCCGAAAAGGAGGAAGGAGATGAGTGGAAAGGAAGGACGCCGGCCTGCGAGGTCGTCTGTAT
CTCCGCCAAGAGCAAGGCCTCACTTCGCGGTAATGTCAGCGGCCTGCTCCGCTATCTCGAAGCGCACCCAGAGACCAGGC
TCAAGGATGTTGCTTATACGACGTGTGCCCGCCGGATGCACCATCATATCCGCATCGCCGCATCCGTCTCAAGCACCGCA
CAACTTGGAGAATTTCTGCGAGCGGCTAGCAATGATCTGGATTCTCATGCAAAACTTGTCTCGAGGGCCGTATCCAACGT
CGTCGTTTTTGCCTTCTCCGGACAAGGCTGCTTCTATCGAGGGGCTGGGGCGGCCTTGTTCGATAGAGCGCCCGAATTTC
GCGAGATTGTCCTCCAGCTCGACCGTGTCGTCCGCCAGCTGGGCTTCCCATCGGTTCTTCCTGCCACAACCAATATCGAA
CGTGATACCTCCAGCTCCTCGCGCACCTCTTCCCCAAGCAATCTCAGCGACAAGGATTTTGCGACTGTACAATCGATTGA
CAGCAGTATAGACAGCACAGCCTCTGGCTGGGAAGCCTCTGAGAGCCCGTTGGTTACCCAACTCGCTCTGGTGGTCCTCC
AGATTGCCTTAGCACAATACTGGCAACTTATGGGCATCACGCCTGGCATCGTCATTGGGCACAGCCTGGGTGAATATGCT
GCACTGTGCACGGCTGGCGTTTTGTCTGTGGCAGACACTCTCTTCCTTGTAGGCAAGCGGGCCGAGCTCATGGTGGCCGC
ATGCGAGCCTGGGAGCCATGTCATGATGTCCGTTCGTGGAGCCTCGGCCGACCGCATCGCCCAATTATGTCAGGGATGTG
AGAACACGTTCCATTACGAGGTCTCGTGCATCAATGGCCGAGAGGACACTGTCATCAGCGGTACCCAAGACGACATGTAC
GCTCTCCGTGACATACTGCAGGCAGCACCTGGCCTTAAGTGCGTCCTGCTCGATGTACCATTTGCTTTCCATTCTGCCCA
GATGGACCCTATCCTCGATAACTTTGAAACCGCCGCTCTCCGTGTCACGTTCAAAGCACCCAAGATTCCTGTCATCTCAC
CGCTCCTTGGGCAATCTGTGGCCAAGGAGAAAATCATCGATGGGGTCTATTTGCGACGGGCCACTCGCGAGACGGTCGAT
TTCGTGTCTGCAATCAACGCATCTGAGACAGAAGGTCTTATTGACAGCAGTGCCGTATGGATTGATATAGGACCACACCC
AGTGTGTACCTCCTTTGTTCGGAACTGTCAGGAGAAGAGCGGACCTGTCCAGGCGTTTCCGTCGTTGCGGAAGGCCGACG
ATGCTCTGTCGGCCTGGAGTGGAAGTTTGGCAGCACTTCACTGCCTAGGCCTCCCCATTGCTTGGAATGAGTACTTTGCG
CGTAGCGAAAAGTCGCATCGATTGCTTTCCCTTGAATCGTACCATTGGAATCAGAAGAACTACTGGATCCCCTACGAAGG
CGCGTGGACTCTTGACAAGGCGAACCCAGCGCTTGCTGCAGGACACAAGACAAGCAATCACGGCTCGAGAAAACCGACTT
TCCTTACTTCATCTACGCAGCAGGTCGATTTTAAGGATGTAGGGGAGCAGATGGCACGCATGACCGTCGTTTCCGACATA
TTCCACCCCGATCTGCTTGGAGCAGCGGCTGGGCACAAGATCAATGGACGGAGTGTATTGACTGCGGTACGAGAATCAAG
CATTTTGGAATCAACCTCTCTAGTGCAGTTGTTTGTGTCATTGCTAACTCTGGCCTCTTCAGAGCATCTGGGCCGATATC
TGTCTAACTGTTGCCGAGAATCTTTATAGACGACTGGCACCAGACGCCGGTAGACTTTACATGGACGTGAGAGAGATGGA
GGTCGTCGAGGCTCAAGTCGTGTCCGATGAAGACCCATCACCCGGGTCTACACCAGTGCAGTTCATTCGCGTGGAAGCAC
TGCTAGACATGTCTCGAGGCCAAACGCAAGTGAGCTTCTACTCTGCCAACCCCGACGGGACACGCAAGACGGACCAGGCC
TTCGCGACGTCGGTAGTCTGCTACGAAGACCTGAAGACCTGGCAGGCCGAGTGGCAGATGGCCTCATACCTTGTCGCCTC
GCGTATCGATGCCGTGTGGAATGCGACGTCCGACCGCCAAGTCCTGTCGCGAGCGAGCCGCGAACGAGTGAGCGTACTGT
CTCAGGGCGCGGCGTATCACCTTTTTGCAAACATTGTCGATTACGGAGTTCGATACCGCGGCATGCACCGTGTAGCCCTG
ATCGAGGACGCGTTGGAAGCCACGGCAGACGTGGTGCTAAATGCAGACCGCCACGGCACTTGGAATACACCTCCCCACTG
GATAGACGGCGCCTTCCAACTGGCCGGATTTATCATGAATTCGTTCGGCGTGCATAATGTCGACGGCTATGATGACCCTC
CGGTCGCCGGCTCGTCTCGGGACTTCTTCTACATCACACCGGGATGGCGGCACCTGCGCATGGCAGAACCGCTCGAGCCA
GGTCCCGACGTTATGTATCGCAACTACGTCCGCATGTCGCCCATCGATGGCGAAACAGGAGCATATTCGGGCGACATCTA
TCTTCTGAGGGGCGCGAAAATCGTGGGTGTCTGTGCAGGCATCAAATTCAAGCGTGTCCCCCGGGCCTTGATGCCAATCA
TGTTTCCTCAACGCCAAAAGAAAAAAAGCGGACTTCCTAGGCATGTTCCAGATCAAGACCTCGTTTCTTCTGGCTTCGAC
AATGCAAGGCCATCCGTTGCAGCCATCTCCGTTCCGCAGCAAAAAGGCCAGGTGCCCGTGACAGAGCTCCTTGCTGCATC
GACCTCCATAGAAGCTAGCCAGTCGAAAACAACGGAAGGCGGACAATTACCCCATGTAGCCGCCTGCATTCAACTCATCG
CGAATGAGACGGGACTGGACACGGACGATATTTCAGCCGAAGCCGCATTTGCCGAACTGGGTGTCGATTCCTTGATGTCT
CTTACACTTGCGGCTAAGATCCAGACCGAGCTAGGTATCTCGGTAAAGGCGTCGGTCTTTCTCGAATGCCCCACCGTCAA
GGACTTGGAGAAATGGTTGACGAAGCATGGCCCTCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62