GenePrediction:GLEAN_2836 Details

Name: GLEAN_2836
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3602150..3604638 (+ strand)
Length: 2489
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3602150..3602377 (+ strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_140:3602443..3602529 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_140:3602581..3602707 (+ strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_140:3602775..3602892 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_140:3602956..3603142 (+ strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_140:3603208..3603379 (+ strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_140:3603436..3603568 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_140:3604218..3604638 (+ strand)
Length: 421
>GLEAN_2836 class=GenePrediction position=GCSC_140:3602150..3604638 (+ strand)
ATGAGCAGCCCAGACGACGTCGAAAGGCGACCGATTGTCCACGAGGAGACACCATTGCTGCGCGCAGACACTGGCGCCGA
TGCAGCAACCGAGGACGAGGGCCGAAAGGAAGACATCGAGCGCACTCCCGCTCGATGGTACGTCTGGAGGGCACTTTGGG
CCGTTGCAGCCGCTGTCGTGGTGGCCCTCTTTGTCAAGGGGTGGATCAACGCGGGCGGCGACGTTGATGTGTGTCCAGCT
GTCCAGCGAGCTTGAGATGTTTAATTCCTTCCCTGCTGACGCTCTTTTTGCAGTTTGATCTGAAGGGTGCCCTCAAACGA
GCACTCGGGGGTGGTTTAAGCGGCGCAGCAGCCATGATCCTGCAGGTTCTGCTTCTCATGGTATGTCTGTTGTCCTGCAA
TGTTTGTCTTCTGAGCTGACGGTCTGCCCAGCCGCTTCGAACGATTATGAACTACCAGTACCGCTTTGGACATTCATTCA
CCGCTGCCAGCCGGATACTGTACGAGGACGGAGGATACGGCCGGTACTACCAGGGCCTTGGTGCTGCCCTCGTCCAAGGT
GAGTTCCTGGAGCATATCCCGTTCTGATAAGTAAACCCGGGAATACTGATATGGATACGCCACAGGACCTGTCTCGAGAT
TTGGAGACACAGCAGCCAACGCTGGAATTCTTGCGTTACTGCACTCCAACTCGTACCTGAAGGACCTGCCCTCCTTCATC
CAGACCGTCTTTGCATCTCTATGGTAGGTCGTCTATTTTGTCCTGCCTCGAATTTGTTCGTGTACTGATTTGTCTGATGC
CAAAAGTGCCGCCTGTTTCCGGATGACTCTCACCCCCATCGACACTCTCAAGACAACCCTGCAAGCACAGGGTGCTCGTG
GAACGAACCTGCTTCGCCAACGGATCAAGACGGACGGTGTGGGCAGTCTTTGGTGGGGTGCGATAGCCACTGCTGCGGCT
ACGTTTGTGGGACATTATCCCTGGTTTGCTACCGTATGCTTGGCCTCCCAACCTTTCTGAACCTATCTTACGTGCAGCGT
CTCACTGTTTGGTCACAGTACAATTTTCTGTCCGGGGCCATCCCCGAGCCCGCAAAACACCCCATAATCGTGTGGCTTTT
ACGCCTCGCGTTTATCGGCTTCATTGCCTCCATCATATCCGACTCCGTGTCCAACTCGTTGAGAGTCGTCAAAACTTACC
GCCAGGTCAACGAAACAAAAGTATCGTACAGTAAGTGAAACTCTCTCGTCATCAGATGATTGGACCACCCGCTGACCCCG
CGATAGCCGAAGCCGCAAGACTGGTGGTGCTCGAGGACGGACTTCCGGGCCTTTTTGGCCGTGGACTCAAGACCCGCATT
TTGTGTAATGGACTTCAGGGCCTGTTGTTCTCCATTCTGTGGAAAGTATTCCTCGACCTGTGAGTATCTCGCACTGCCCT
ACTGGTGAAAGTTTGGACTGACGAAACCTCAGCTGGGAGAAGAAGACTGGCTCTTGGGGTTTGATGCAGGCTTTCTTCTG
AGACATGAATTCCCGTACTGGCTCGAATACATCAAGGGCCGTCTGTACGAAACTGAAAGCCACGAGGATTGGATAATCTC
GATAGACTAACAATCAGATACACGACTTTAGCGATCTACCAAAAGATGGCATTGGTGTTATTGGTTGTCTTGGTGATAGT
AGGGTCTCTACTTACAAAAATAGAGGGCTTATTTCAGGTTAAAGTTCTCGGCTTATAAAACGGAATCAAGCTCCATGTCT
GTATATTATGCGGCTATCTCAGGATTGCAGCACTGCCCTATGAAAGGATAACTTGAACTGAGAGATCACACAATGATCTT
AATATAACGAATAAGTAATTCGTAACCAGACTTAAAATAAATGCTGAAGCCTATTTTTATCGTACAGGCAACCAAATTAA
CAGCCAGGCTTCAGTTTGGACCCCGCCATCGTGCAGACAACACAGTTGCTACAAAGCATAACTCTAATGCACAGGCGTCC
AGCAACCCAGTACCTACCTATTGGCCCAGCATACTGATTAATCTCAAAAATTTCTCCAACATGGCAAGCCAATCCACGTC
TTACACAACCAACTTCGCCGCCAAGCAGGAGTCCTTCCAGGCTGGGCTTTTAAGTCTTTTCTCAGGAAATACGGAGGACA
CCGAGGCAGACTTGTCCAAACTCTTCCACCCTACTTTCACACAACAGGACAACGATGGCATGCGCGACTTTCCCGCGTTT
GTTGAACATATCCGCCATCTTCGCAAAATCTTGCCCAGCGTCTTTTTGGTCGTCACTCAGTTCCTCCGAGACGGAACGCA
GTTTGCGGACAGGCACATTTCTTCTACGACCCTGCCGGATGGAACTGTTGGTGGCGCCGAGACTTTCATGTTTGGTGAGG
TGGCCGAGGACGGGCGTCTGGTATGGCTTTCGGAGATCGTGCGGCGGCAAGAGTTGACGGAGGATGAGATTAGGATGTTG
GAAAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62