GenePrediction:GLEAN_2837 Details

Name: GLEAN_2837
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3606932..3608059 (+ strand)
Length: 1128
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3606932..3608059 (+ strand)
Length: 1128
>GLEAN_2837 class=GenePrediction position=GCSC_140:3606932..3608059 (+ strand)
ATGGCAACTAACCAGCAGTTGTCCACGACCACGACCACGACCATCACGGTCGAGGGAGAGTTGCCGGGCGCAGTGCCATC
GTCGCGACTATTGCTCCGGCTGGAGGCGGCGCTGTTCCGGTCGCTGGCGTATGTGGGTGCATGTCTGCACTTTCTGGCAT
CGCCACAGCCTCCGGCGCCGACGTTTACGCGCACTGTGAAATCAACGCTTTCGAGCCACACCGGCACCTTTACTCTCCAC
GTGTACACGCCAGCGGGTTATGACGACGCCGACAGCGACACACTCTATCCTGCTGTCGTCAACTTCCACGGCGGCGGATT
CTCCATGGGCTTGGCAACGGACGACGCCCGCTTTGCCCGCGTAGTCGTGGAGACATGTGGTGCCGTCTTCGTGTCCGTAG
CCTATCGACTGGCGCCCGAGTATCCGTTCCCAACGGCAGTGGACGATGGTGCGGATGCGCTACTTTACATGATCCGGAAT
GCGGCCGCGCTTCATATTGATCCACAGCGGCTGGCTACGTCCGGCTTCTCGGCCGGTGGCAACATCGCGTTGACATCGTT
GTTGCGTCTGGGTGCCTACCTCCACGACGAACCGACAACGACAACGATGGAGACAAGTCTTGCGGAGCCGGTTCCATCAC
ATCGATTTGTGGCTACGGCTACCTGGTATCCCGTCACAGAGTACACAAAGACGCGGGCAGCGCGGCGAGTGGCGTCCCGA
CGGCCAGAGAAGACGATGCCTCCATTTATGACCAACCTCTTCGACAACTCTTACGTATTCCCGCCCACCATAGATCGCTC
AGACCCGCTTTTATCACCATCACAGGCGTCCGACGCACGACTGGCGCGTGACATGCCGCCCCACATAGTGTTCTACACGT
GTGAGTGGGATTTGCTTCAGGCAGAAGGCGAGGCTTTGGCCAATCGCCTCCGAGACCCACCGCTGAGCAGGGACGTGCAC
TACAAGATGATCCCAAAAATGCTGCATGGCTGGGACAAAAGCCCGAATCCGCGGGAGCTACCGGTGGGTGCGGGGGCGCT
GTATCTAGAGTGCTGTGGTGTGCTAAAGGATGCTTTTAACGTAGCAGCGAACGCAGTAACAGGACAAGACCTCGAAACGG
ATACTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62