GenePrediction:GLEAN_2839 Details

Name: GLEAN_2839
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3616952..3618704 (+ strand)
Length: 1753
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3616952..3617211 (+ strand)
Length: 260
Type: CDS
Source: GLEAN
Position: GCSC_140:3617282..3618225 (+ strand)
Length: 944
Type: CDS
Source: GLEAN
Position: GCSC_140:3618283..3618704 (+ strand)
Length: 422
>GLEAN_2839 class=GenePrediction position=GCSC_140:3616952..3618704 (+ strand)
ATGGCACAGTACAACATCCAAAGCGAGAGCAAATGCATCTTTGAGACACTGCTCCAAGATGAGACACTAGCCCTGCCGAG
CTCATTTGTCGAGGCTGCAAGAAAAGTCACCTTTGTCGGAGACGACCCGAAACCGTTTATCCCAACGCCATGCAAGATCA
CCGAGTCGTCCTCTTCTCTTACCGCGTTAGTTGCTGCTGCGGCAAGTGCCGTGGCTAGAGATCGGTATGGCATCGACTAC
CAGGAAATCGAAGTCAACACGTGAGTAGCATCAGCTTGGGGCTTTTTTTTTCCGGTAAACAAAACAAAATAAGTTGCTGA
TCAGATGCAGAGATCTTGCCACTCTGTTTCTCGAGTCCGTCCTCCTGCCTACCGTTAACGGTGAATCCTTCCTGCAGAAC
CCGACACTGCAAGCAGAATTCAAGAAGGGTGATCTGTACGAGATAAACAAGCCTATCCACATGGAGGCCACCAACGTCTA
CAAAACTAGTGATGGCCGCTACTACCACCTGCATGGTTCCTTGAATGCTGCTGCGACTATGAAGATGATTGGTGTTGAGG
AACAAGACGTGACACGTGACGAGGCTATTCAGATCTATACGAACAAGGTGGCACAGTTTAATTCTGAATACCTGGAACAG
ACAGCAAATGAGGTATATAAGGAGGCTGGCGTCACCTGTCTTACGCCCGAAGAGTTTTTTGCGTCAGAGCAAGGGAAGAT
TATGAGTGCCGAACCTTTGTGGACTACACGGGCTATTCTGGCACCAAAGACCTCGTGGCCGGATCTGCCGGACAAAGACG
TCGACCGGAAGTTCAAGCCGCTCGCAGGCATACGTGTGATTGATTTTTCACGCGTTGTGGCTGCTCCCGTCATCTCTAAG
CTCCTGGCTCTACTTGGGGCTGACGTGATCAAGGTCACAAGCAGCGGCCTGCCCGACATATCTATTTTGTGGATGGACCT
CAGCACTGGGAAACGCGATGCCAACATCGACCTCAAGACAGAAGAGGGAAAAAATACTTTTGCCTCATTAGTGGCAGGTG
CAGATGTCCTTATTGATGGGTATCGCCCTAATGCGCTGGCACGACAAGGCTTTGACTCGGCAAGCCTGCGCAAGATCAAT
AGCAAGCTCATTTACGTGCGCGAGAACTGCTACGGATTTAAAGGCCCACTGGCCCATAGATCCGGCTGGCAACAGATCAG
CGACTGCTTAGTCGGCATCTCGTGGCTGCAGGGCCGCTTTCTAGGGCTCGACGAGCCGGTTGTGCCTCTCTTGCGTAAGT
CTCAGGCTAGAGCAACCAAGATGCCCATCATTACATATGCTAATAGCACAGCAAACTCGGACTACCAGGTTGGCCTCATC
GGCACCATTGCCGTCCTCAAGGCACTGTTGGAGCGTACCAAAAGCGACCAGACGTTTGATATTGATGTCAGCCTGACCCA
GTACAATATCTGGTACTACAGACTCGGACAGTATGACAAGGAACAGGCAAGAGAACTGTTGGCTCGTAACGAGGGCTTTC
ATGCACGGCACTATGACGAGATGCAGACGCTGCTTCAGAAAACGCTGCAGGCGATGCAAAAGGCCCGGCCAGATTTATTC
AACCGGCCAGATCTTTACTGGAAAATGTCCGGCAAAGAATGGGGACTCGACGACGACATCCTAATCCTAGCCCCAGCCTT
CAAGTTTGACAAGACGCAACTTGAATACACGGTCCCGTCTGGGTCAAAAGGACGGTCAAAAGCCGAGTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62