GenePrediction:GLEAN_283 Details

Name: GLEAN_283
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:765146..766254 (+ strand)
Length: 1109
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:765146..765212 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_167:765266..766254 (+ strand)
Length: 989
>GLEAN_283 class=GenePrediction position=GCSC_167:765146..766254 (+ strand)
ATGGGAAAAGCAGAAGTCGGATCGGTGAAGCACCTAAACAATCAGATGAAGGCCAGAGGCCTGACTCGTGAGTTTTTCCC
TCTTCGCCCAACATTGCCACTCCGCTAACGAGCGATGCAGGATTGCGATGGTATTGTCAGGTATGCGAACGTGCCCTGCG
AGACGAGAACAGCTTCAAGCAACACACCCTAAGCGAGAGCCATGTGCGCAACATGCTTGCAGTAGGCTCCAACCCGCGCA
AGGTCATCAACGAATACTCGGATCAGTTTCTCAAGGACTTCCTACAGCTTCTGCGCACGGGACACGGCGAGAAACAGGTG
CAGATCAACCACTTCTACCAGGAATACATTGCGAAACGCGACCACATCCACATGAACTCCACCCGCTGGTCCTCGTTGAC
CGAGCTAGCTAAGCACCTCGGCCAGGAGAGCATCTGTCGCGTCGAGGAGAACGAGAAGGGCATCTTCATCTCATGGATCG
ACACATCGCCCGAGGCGCTGCGACGACAGGAAGCCTTGCGGAGGAAGGAAGCACAAGACCGTGGCGATGAGGAGTGGGAG
CGGCGAATGCTAAAGGCACAGATTGAGCGCGCCGAACGAGCGGCAAAGGAACGTCGTGGAGACGAACAGGCCAGCGAGGA
TGAGGACGAGGAGGACGACAAGAACAACCTTCTGGAGCGACAGGAGGGCGAAAAAGTGAAGCTCTCGTTTGGAAGCGCAA
AGCCTGAATCCACGGCGGCCAAAGAGGCAAAAGCTCCACCAGTCTCCGATGAACAACAGCCTGCATCTGGTGTGAAGGCA
GAAGACGAGGCCGGAGTCGATAAGAAGACGGAGCCGGCTGGCTTGGCGGCACCAGCAGCTGTTCCCACAGCCGCAAAACC
AGTGTCGCTCAAGCTCGGCGGGTTGAGCAAGCCGCAGCCCAAAAACGTCTTTGCTGCTGCGAAAAAGAATGCGTTATCCG
GAGGGGGGGGCAAGAAGATTGAATTGCCTAAGAAGATGAGCGAGGCTGAGCGCATCATGAAGGAAGAGCTGGAACGAAAG
CGGTCGCGCGACTTTTCCAGCCATGGAGCCGGCCGCTCCAGCGGACCAAACAAGAAGCCAAGGGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62