GenePrediction:GLEAN_2840 Details

Name: GLEAN_2840
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3626878..3630148 (+ strand)
Length: 3271
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3626878..3626997 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_140:3627049..3627212 (+ strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_140:3627269..3628024 (+ strand)
Length: 756
Type: CDS
Source: GLEAN
Position: GCSC_140:3628081..3628368 (+ strand)
Length: 288
Type: CDS
Source: GLEAN
Position: GCSC_140:3628434..3628648 (+ strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_140:3628705..3629256 (+ strand)
Length: 552
Type: CDS
Source: GLEAN
Position: GCSC_140:3629313..3630148 (+ strand)
Length: 836
>GLEAN_2840 class=GenePrediction position=GCSC_140:3626878..3630148 (+ strand)
ATGCGCGCCTTCAGCCTGCTCTGTGCCACCGTCGTGAGCACCTCGTTCTCGACCGTGCTTGCGTCTCTGGGCCAAGACTT
CGCCGCATACAATGCTGCCCATCCGGGACTCAACGACATAGTAGGTCCCTTTTGTCCTCCTGACCAGCCGCGGGCCTGTG
CTGACCGACAGAACTCGGATGACAATGACTTTGTCAAGTTCAAGACGCCCGACTACTCCAACACCCTGGGCTCGCCGACC
GTGGCGCAGTCCGTGTCGCCTGTGAACACCTCTGTCAGCATTGTTCCCAATGCCTATCTCATCCAGCTGGCGCCCGGTGC
CAGCCTGAAGCGCCGGTCCGTCTCCTCCGTGTCCGTGATGGGACTCCGTACCCGATTGCTGACCAGAACAGGGGCGTCCG
CGTGGGCGATGAGCACTTCCAGTTCCACAAGCGGGCAGAGCCGTCGATCCGGTACAACACGCGCCTGGAGTTCAAGAACC
CCGACGTCTTCCTCGGCCTTTCCATCCAGGTGCAGGACAGCAGCAACGCCAGCACGATCCAGCAGATTCCGGGAGTCGTC
AACGTGTGGCCCGTCCGGAGCATTCCGCGACCGGCCCCCATCGGCAGCGGCGTCACGGGCACCATGGTTTCCGGCAACTC
TTCCTATCACGTGACTGCACAAGCTGGTCGCGGCGCCGATGTCAACCACCCGCACATCATGACGGGCGTAGACCGGCTGC
ACGCACTCGGCATCAAGGGACGGGGCATGAAGATTGCCGTCATGGACACGGGTGTCGACTATCGCCACCCGGCCCTCGGC
GGCTGCTTCGGTAAGGGCTGCAAGATCTCGTTCGGCAAGGCCTTTGTCGACGACAACTACGGCGACACCGGCGTGGCCGT
GGCAAGCGATGACCCGCTGGCTACCTGCCTTGGTGGCGGCCACGGATCACACACGTCGGGTATCATCGGCATGGAGGATC
CGGCTGGCTCCACGTTCGGGCTGGTCGGCGTCGCGCCTGAGGCTACTCTCGGCATGTACCGCATCTTTGGCTGCTCCGGC
GGCGCCTCGGACGACATCATGATGCTTGCCTTCCAGCAGGCTGTCGAGGACAAGGTCGACGTCCTGAGCATCTCCCTAGG
CTCTGTTGAGCGGTGGCAGCGAGACGAGTACGTCCCTATGCGTATGCCTACAAATGAGCTTCTTTGCTAACGTACATCGG
CAGCCCGTTCCTCAACGTGACCGCCTCTCTCGAAGCCCAGGGCATTGCCGTCATTGTCGCAGCAGGCAACGATGGTGGCC
CGGCCCTGACTTCGTCTCCGGCTGTGGGCGAAAAGGTCATCGCTGTCGGCTGCTTGGACAACGCCAAGTTTCCCACTGTC
TACACTGCCCGGGACTCCAACGGCAACTCTCTCCAGTACTCCGGCAACCCTTGGCCGGTCTCGGCACCCAAGACTGGCCT
CAAGGTGTACGACATGACTAAGCTTGCGTCGAATACGACCTCGCCCGTTGGGTAAGTCCCACCCTGCTGTCTTTTTTTCG
CGCTCTCTTCGACCAGCTCAGCTGACAGACTTGAAGATGTACTGTCTCTGCTTGGGAGGCTGCCTTTGCCGGCATCCCAA
ACCCGAACAACTCCATCATTGCTGTCCCTGCCAGCTCGGCTTGCAGCTGGGCCGCCAAGCTCAACGCTGCTGCCACGTAT
GGCCTGCCGTACGCGCTCGTCTATGCTGTAGACGACGGCGGGATTTTCGTCAAGGACCTCAATACCATGGAGCCTAGCAT
CCCCAACTACGGTATGTCACTTGTACCGCCCCAGATCGACTCTCTCCTCTCTGTACTGACAGGCCAGGCATCATGCTTAG
CGTGGACGACGGCAAGAAGGTTATCGCAGGCCTCGCCAGCGGTGGCGACTACAAGCTGTATTTCGACAGCAAGGTGTTCG
AGTCGACGGAGCAGCCATCGGCCGGGCTGATGTCCTACTTCTCGTCCACCGGCCCGACGTCCGACACGCTGCAGATCAAG
CCGCAGCTTTCGGCACCCGGCGAATCCATCCTCGCCACCTGGCCGCTTGAGGGCACCGGCTACGCTATCCTGAGCGGTAC
CTCCATGGCCACGCCGTACGCGGCTGGCTCCTACGCCCTCATCAAGTCGCAGCACCCGACCGAGTCGGTGCAGCAGATCC
GTGAGCGCCTGCAGAGCAATGCCAAGAGCATCGTGTACACCTTTGACAACACGACCCGCGACTCGGTCACGCAGCAGGGC
GCTGGCATGATCGATGTGTTCAGCGCCGCGTTCGTGCCCTGGACCGTCTCGCCGTCGGAGCTCAACCTCGGCGATCTGGA
CGCCTTGGTGCCCCAGACCATCACCGTCACAAACAAGAGCCCGTCGGCCAAGACGTACAGTATGTATTCGTCTTGCGCAC
TGTGTTTTGGCACTGCTGACCACCTGTTCCTACAGCCATCACCCACGAGCCTGCGGGTGAGTCGAACCTGCTGCCTGAGC
AGTATCTCGTCGTACTGGACGGCACAGAGGTCGCCCTGGACGGCCAGTACAAGCAGTACGCTACTGTCGGCTTCTCCACG
ACGACCCTCACCCTGGCGCCGGGCAAGTCAGCCAGCTTTGTGGCCACCTTCACCCCTCCGACGGATACGCCGGACCGCTT
CCTTCCCGTGTACTCTGGCTTCATCAAGGTTAGCAGCGGCTTCGAGTCCGTCACCGTCACCTACCTTGGCCAGCCGTACT
CCCGGAAGAAGGCCGATGTGATCGACAACACCAACGTCACCGGCTCAGTTGTCCCCTGGATGCTCAACTCGCATGACTTC
TTCACGCCCCTGCGCGACATTGGCGTGTTCGACTTCAACCTCAGCGGTCTGGGCTACCCCTACCTCGAGTGGGTCACGCT
GCAGAACTCCCAGCTGTTCTACATTGACCTGCTGCCCTACAACACCAGCGTCGTGCCCGACTTCTACGGCTTTGACAACA
GCACCAACCCCTACGGCGTGCCGAACTCGTCGCTGCCCATGATCTACCCTCCCTTGGCGCTGAACTTCACCTCGGCTGGG
GTTACATCGTACGGTCATGTCAACCAACAGCTCTCGAACGTCCGGCCGTCCGGCTATGTCTGGCACGTGGGTCCCGAATT
GTACGATGACAACATCGATGTCATCACCGAGATTCTGCCGGGCGACTACCGGGCACTTCTACGTGTGCTCCGTTACGGTG
CCAAAGTCAACCTAGCTTCGAGCTACCAGACCTGGCTCTCCCCCGTCATCCGCGTCGCAAGCTCTTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62