GenePrediction:GLEAN_2845 Details

Name: GLEAN_2845
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3660613..3661046 (+ strand)
Length: 434
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3660613..3660683 (+ strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_140:3660848..3661046 (+ strand)
Length: 199
>GLEAN_2845 class=GenePrediction position=GCSC_140:3660613..3661046 (+ strand)
ATGAACCAGCAGGTCATTGACGGCGCTACCTCGAGCGACCAGCAAGATGACAGGAGGATCTTGCAGAAGCGGTATGTTTT
TGTATATCTATTCGGAGCAGCGACTGCGCTAGGAACATGGTGTCGCTTGAGCGCCAGCTGCACAAATGGTGGGCGTTGGG
CTACTGGGGCATGAGGTGCTTTGGCGCTCTACTTGTACAGAGACAGCGACGGCAACGACCGCGCTGCTGCAGCAGAGATT
ACTCTGCAGTTTCACTAGCTACCGCGGCAGGTGACGAGCGCGATAGGCCAACCGACTTCGGACTGGCCTCTGGAGAGGCG
GCTGCTCTGTGGACGGAGTGGTCGGAGGAGCTGCTGCAGCACTCTAGCGACCCATATCCAGATTCGGGCGCGGGCTCGCA
GCAGCGATCCCGGCAAGCAGTCGTATGCTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62