GenePrediction:GLEAN_2846 Details

Name: GLEAN_2846
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3664099..3666010 (+ strand)
Length: 1912
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3664099..3664174 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_140:3664312..3665641 (+ strand)
Length: 1330
Type: CDS
Source: GLEAN
Position: GCSC_140:3665692..3666010 (+ strand)
Length: 319
>GLEAN_2846 class=GenePrediction position=GCSC_140:3664099..3666010 (+ strand)
ATGGGAAAGTCACTGGCCTTGCCGAGCCAAGGGGAGACAAACTCTCCCAAGCAGAACGAGACAACTGCCGACACAGGTAC
GTTTCCCTTTTCACGCCACATCTTCTATAATGCGTCATGCCAGGAGCAACAGACAGAAAAAGGAACCAATCAGTAGAAGT
CGATGGGGAAGTTATGCATGGCTCGTTGCTGATTTTTCCTTTGTTGTTTTTAGACCGTCACAATGCATCTTCCAATCGCG
CAGACGCCTCGAAGGTCGAGCCATCTGATACCGAGACTGCCAAACCTCTTGCTCCTCCGCCTCGGCCCAACCAGCAGAAC
GGGAATACGCCCGACTACTTCACAACACAGAGCGGTGGCTCCCTAAGCATGGAACCGAATCCTTTTGAGCAGTCATTCGG
TGGCGCCCCAGAAACTCCTGGAGGCACCAAGCTTCCTTCGGTTGCTTCCTTGACGTCGCCGTCCTCGCTTCTCCCTGGCG
GCGGGACAACTCCTTTCAACTGGGGAGGTGGTTCGTTGAGGACCGGTCCGCTCAGTCCAGCAATGCTCTCGGGCCCGGCC
GGCGACTATTATGCCGATACCCATCTCCGTGGCGGCTTTCCAACACCGAACGAGTCGTCTCTGCGAACAGGTTTGACGCC
TGGTGGAAGCGGCTCGATGTTCCCTGCGTCAAGTCCCAGCTCGCAGGCTCTCTTTGCGCAGTTGCAGAACGGCAGCGCAA
CCCCCAGCACGCTAGACTTCCATCGCACAGCCATCAACGCGGCTGTCGCAAAACGGGACCAGCAGGCCCATCAGTCCGGT
CAGCAGCACATTGCGCCGCCGACGTCACAGCCATCCATCACGTCACAGCCACAAGAACATCCCTCTATCACATCTGCGCC
TGCGCCTGTACCAGCTGTAAAGGCTGAATCCAAATTGGCAAGTGGCCAGTACGATCCCCACGACAAGGATGCTGCCAACG
GCTTGTATCTTCTGGCTCAGGGTGGCAACGGTACGCAGGCGCAGGCTTCGTTTGCAGTTCCGCCGCCACCGCTGCAGGCG
GCGGTAATAAAGCACACGGCTGTCCCGGTGCCCATTTCCGTGTCCGCATCTGTCGCTGCGATGCAGCCAGCACAAACGCC
TGTAGCACCTCCACAGGACAACAGACAGCGGGCTCCTGCACACAACGGCGTCTCATCAATGAACGGGTCGTCGTCGCATG
CGGCTCCGACCACGATGGGTAACGGCTCTGGCGGCTTCGGTCACGGGGCCAGTGAATCTGGAAGCCCAGGGTCGGAGAAG
AGCGAGACGCCCCGTTTCAACGGGAGAGGTAGGGGCAAGCGCAACTCAACTTCTGACGCAGGTGCTGCAGCAAACGGTAG
GCGGAAAGCACAGGAGATGGCGACGAAAAACAGTCCGCCTAGCAAGCGAGCCAAGACCAACGGCTCGCCATCTTCTATGG
AAGACGAGGATGGCTACTCCGACGACGAGGAAGACAAAGACGGGCAGCCAAAACAGAAGATGACTGAAGACGAGAAGCGC
AAAAACTTTCTCGAGCGAAACAGGTATGTCTCGGAAATGCGCATACACACTTGTGGATGCTAATGGGCACTAGGGTCGCT
GCTCTCAAATGTCGACAGCGTAAGAAGCAATGGCTGGCAAGCTTGCAGTCAAAAGTGGAGCTCTTCACCTCGGAAAACGA
GTCTCTCACTACGCAGATCACACAGTTGCGTGAGGAAATCGTCCACCTCAAGACACTTCTGCTTGCCCACAAGGACTGCC
CGATAACGCAGCAACAAGGCATGCATGGTGCCTTTGTCCAGCAGTCGATGGAACCGTACAACGGCGGTCAGCTCAACCCG
TACAGCATGGCGGCGACAATCTCAAACCAGCAGGCCATCTCGGCACAGGTCGACCAGCGGCGGTTCTCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62