GenePrediction:GLEAN_2847 Details

Name: GLEAN_2847
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3667226..3669185 (+ strand)
Length: 1960
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3667226..3667313 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_140:3667374..3667591 (+ strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_140:3668038..3668335 (+ strand)
Length: 298
Type: CDS
Source: GLEAN
Position: GCSC_140:3668401..3668587 (+ strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_140:3668639..3669185 (+ strand)
Length: 547
>GLEAN_2847 class=GenePrediction position=GCSC_140:3667226..3669185 (+ strand)
ATGACGACTCTCATTCAGACCCGGATACCGCTGCAGGATTTGAGCATGACCAACCAGTCCGATCGACGCTACAGCAAACG
TCTGGCCGGTACGTCAGAGGAGCTATGGTGCATGGTTGTCGTAGTGCTAACTAGTGTATCTTTTGCAGCCACTGCTGTAT
ACGATGAACAGGATGGTGATTTCCACTTCACCCGGGGCTCCAAGAAGGTCAAGACGTCGGCCGAGCCAGAGCCGGTGCCG
GCAACGACGACTACGACGAGCAGGCCCAAGAAGGGCACGGCCAACGGGCGTACAAGCATCAGCAACAGCAGCAAGCTTCA
CAACACGATGGGCCGCAGACGAGCGTCCCCAGCACCGCCATCCCCAGTTCCGGAAACGCCGGCGATCGCTTCTCTCAGCG
CCGCCACGGGCACGACAGCAAAGCCGACGACGGCAAGGCGGCCAGGGCGGCCAAAGGGCAGCGCGACAGCAGCGGCAAAG
ACAGCGGCCGTGCAGCGGCAAAAGCAGCAGCAGCGGCAGACGAGGAGCGGAGAGCAGCGTCAACGCGGACGAGCACGCGG
AAAGCACGTGTGTCCGTAGAGAAGACGGTCGAAGTCGAGGCAGAGCCAGCGCGCAAAGGGCGAGGGCGAAGACCACGTGG
CAGCAGCGGGGGTATCGCAGCAGCAGCAACGCCGTCAGGACCAGTAACTTCAGCTCGATCGAGGAGAGTGGCAGCTGCAG
TCGACGAGGAAGGCGACGAGGACGATGACGTGGCCGTGGTTGATGGCGACGACGAAGACGACGACAACACGGCGGCGGCA
GAGTCGCGGCAGATAGCGCTGCCATTCAGCGACACGCCGATCATCAACCGCAACAAGGAGCTGCGACGACAAGCAGGCGG
CCAGCGACGTAGCAGCGTGGGAATGCGCGGGCGACGGGCAAGCTCGCTAATCGACAACGGGCACAGCGCGCTGCCGCACC
GGGCTGTCGACACGGCCGAGTTTTACAAGCACATCGAGGCGGACCAGGTGGAGCCACGACGCATGCGGCAGCTGCTGGTG
TGGTGCGGCGAGCGGGCGCTGTCGGAGAAGCCGCCACATGGATCAGCAAACGCGAGCGCGATCTTGGGAGGTGAGTTTGC
GTGAGGTTTGGGATTTGGGATTTGATTCGGGTTCTACGGATGCTGACTCATCCAGCGCGGGCGATACAGGACCAACTGCT
CAAGGACTTTGGCAGCCGGGCGGAGTTCTCCAACTGGTTTGAGCGAGACCACATGCCAGAAGAGCTAGCCAAGGAGCGGA
AGAAGACAGTGGTGCTGAAGCCGAACCCGCGGAACATTGAGCACGAAGAGAAGATTGCCGAGCTGGAAGCACGGATAAAG
AGGTGCGTTTCGGAGATGGACAATAACTGGCGATGCCCACTAACACGGCACAGATTGAAAGAAGAGAAGAAACGGTGGCT
CGCACTGGCAAAACCACTGCCAGAACTGCCGCCGCTGTATGGTGCAAGCGAAGATGCAGAGAGAAGGCCGCCAGCACCAG
ACGCGACGTTGCTCGATCCGGAAGAAGCCAAGATGCTGGAGGCCGTGATACCGGTCGCAGGATCAGCATCAGTACCAGCA
GCAACACCAGCACAAGGCACATTACAGCAACCACGGCCACAACTGCAGCCACCTCCAGGGCTGTCGTCGGCAGCCGCATT
CCGGGCGCAGCTGCTGGCGCGACTGCAGAGGTTGCAGACGACAGCGCCCTTCCAGATCGACCATCTGGCGTACGGGGTGC
ATGTGTTGGACCAGCGAGTGGCAGTGGCTGGCCAGGAAGCGGACCGGCTGCTGCGGTTGAGCGCGGCGCGGCTTAAAGAG
CGCGAGGACCGCGAAAAGGCAGCCGTGGGCACCAAGGCACTGCCGATGATGGAGGTATTGCGCAGTCTCGGCCGGATCTT
GCCAGACGACCAGGGTGGAGGCAGCGGGGGTGGCAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62