GenePrediction:GLEAN_2848 Details

Name: GLEAN_2848
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3671992..3673130 (+ strand)
Length: 1139
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3671992..3672001 (+ strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_140:3672166..3672267 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_140:3672335..3672745 (+ strand)
Length: 411
Type: CDS
Source: GLEAN
Position: GCSC_140:3672826..3673130 (+ strand)
Length: 305
>GLEAN_2848 class=GenePrediction position=GCSC_140:3671992..3673130 (+ strand)
ATGCCCAAGTGTAAGCTGCGCCCTTCTTTGTCCCGCCCGTCCTGCTCTGCACGCCGCCTGCTAACGCGCCGCTTCTCTCC
TGCTGCAGTCTTCTGTACGTCGTTTCTGCTCGCAAACAAACCCTCACTATCTCCCTCCCATCTGATTCTAACCCTGCCCT
CCGCTTCCCTTCAGGCGACTACTGCGATGTCTACCTCACGCACGACTCCATGAGCGTGCGCAAGGCCCACAACAGCGGCC
GCAACCATCTCCGAAACGTCGTCGACTACTACCAACGTAAGTCTTCCCTCGTCTTTTCTTTCTCACAGCCTCGACTCGGC
ACAGCTAATCGCCCACCTCCCAGAGATCGGCCATGAAAAAGCCCAGTCTGTGATCGACTCCATCACCTCTTCCTACGCCG
CTGAGGGCCAGGCCCACGCCAACCCCATGCTTCCCCAGAATCAGCCTGGCTATGCAGCTGCTCAGGCCCGATTTGGTGGT
GGCGGTGGCTTCGGTGGCCGTCCGCCTTTTATGCACAACGCTGCTGGCTTCGGTGGTGGTGCCCCTAACAGAGGCCCGCC
AGGTGCCCCCGGTGCTGCCGCCTCAGGTCCGGTCCATCTCGGCTCCGGCTCCGGCGCCCTGCCTGGCTTTGCTGGTGCCG
GTGTGCCACCACCTCCGCTGCCCTTTAACTTTCCCGGTGGAATTCCTCCTCCTTTGCTGCCTGGCTTCCCTGGCAGCGCC
GGACTGCCTCCCCCGCCTGGTGGCGCCTTCATGGGTTCGTCTTCACTCTCTCTCTCTCCTATGACTCCTTTCTTGGACCA
TTCTTCCCTCCGGCTAACAAATTTGTTCATCCAGTCCCCGGATCGGCTCGCGGCCTCCCCATTCCTCCTCCTCTGTTCCC
CGGTGGCCCCAATGGAGCTCCTGGTGCTTCACCCGTCCAGGGCATGCCACCTTTCCCCTTTCCGCCTCCCATCCCCGGCC
AGGGCTCGTCTTCTGCTGCTGGCCCCGGAGGCATGCCGCTGCCTGGCTTTCCAGGCTTCCCCGGCATGCCGCCTACTGGT
CCCGGCGGACAGCAGGGCTTTCCTCCCTTCCCGCCACCATTCATGGTTCCGGGTGGCCCCGGCATGCCGCCGTCTCTGCA
GAGCGGAGAAAATCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62