GenePrediction:GLEAN_2849 Details

Name: GLEAN_2849
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3680011..3680557 (+ strand)
Length: 547
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3680011..3680220 (+ strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_140:3680287..3680386 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_140:3680463..3680557 (+ strand)
Length: 95
>GLEAN_2849 class=GenePrediction position=GCSC_140:3680011..3680557 (+ strand)
ATGTTGCCGACGGCCCGTCTATTGGCCTCTGCTGCCTCCAAGGCTGGCCTACGGCCACCGCCCATGGCCGTGCTCCCGCC
TATTCCGCTATACCGGAGGCTTCTGCGGGCCCACCGGAATCATCTGCCACAGGACATGCGTATGTTGGGGGACGAGTATG
TCAAGGCGGAGTTCCGAGCGCACCGAAAGGTCGACAACCCAGCTCATCTGGTAGGCGGCTCCATCCTCCCTCCTTTCTTT
TTATATATGCTAGCCAATGTGGCTGACCGCGGACAGATCGGCTTCCTTACCGAGTGGCAGCTGTATGCACAGAAAATCGA
GGGCGACTCGTGGGTGGGCGAGAAACTGGACCCCGTCAAGGTATCCAAGATGAATGGTACGTCAGATCTTAACTCGTAGT
AACTCCTCTTTGTACCCCATCAATTCCCGCTTTATCTTTCTGACACAATCAGACCAGCAAATCGGCCAGTTGTATGAGCT
CATGGAGGCAATCAGAAAGCACCGGAGCGGCGAAGCAGACGAGGGCGAGGAAAGTGGTAGTTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62