GenePrediction:GLEAN_2850 Details

Name: GLEAN_2850
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3684588..3685261 (+ strand)
Length: 674
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3684588..3684611 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_140:3684683..3685261 (+ strand)
Length: 579
>GLEAN_2850 class=GenePrediction position=GCSC_140:3684588..3685261 (+ strand)
ATGTTGTCGCGGACCATCACGAGGGTATGTATGACGTGTGTGCTGTTTGTTTGCGAGAGAGAAAGGGCCTTTGCTGACTT
ATACTCTTGTTGCAGCCGTTCGGCCGCCTGGGAAGCCGTCCATCGGCCGCCTGCTCGTCTTCCGTGTTCGCGCCCACTTG
CTTGGCAGCATCGTCGCCCTCCTTCTTCTCGACCTCGACAGTCGCCCGGTTGTCATCCCGCCGGCCCTCTGCCCCCGTCG
CCTCTCCCGCCTCCTTCGCCCTCTTCCAGCACAGCTTTCCCGGCACGCGGCGGTTTCTCTCGGACCACACGCGCGAGGCC
ATTGACCGGGCTGTGAAGTCGGCGCCCGTGGTGCTCTTCATGAAGGGTACACCAGAGACGCCGCAGTGTGGCTTCTCGCG
AGCGACGATCCAGATCCTCGGCTTGCAGGGTGTTGATCCGGCCAAGTTCTCCGCCTTCAACGTGCTGGAGGACCCGGAGC
TGCGCGCCGGCATCAAGGAGTACTCGGACTGGCCCACCATCCCACAGCTCTACGTCGACGGCGAATTCATCGGCGGCTGT
GACATCCTCGTCTCCATGCACCAGGGCGGCGACCTCGCCAAGCTATTCGAAGAGAAGAATGTGCTCATCGCCGCCAGTGA
GGAAGATGCCCTGGTCGAGGAGAAGAAGGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62