GenePrediction:GLEAN_2852 Details

Name: GLEAN_2852
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3690922..3693022 (+ strand)
Length: 2101
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3690922..3691141 (+ strand)
Length: 220
Type: CDS
Source: GLEAN
Position: GCSC_140:3691200..3691375 (+ strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_140:3691442..3691716 (+ strand)
Length: 275
Type: CDS
Source: GLEAN
Position: GCSC_140:3691792..3692216 (+ strand)
Length: 425
Type: CDS
Source: GLEAN
Position: GCSC_140:3692280..3693022 (+ strand)
Length: 743
>GLEAN_2852 class=GenePrediction position=GCSC_140:3690922..3693022 (+ strand)
ATGCGTTGGCAGCAAAATAGCATCCTGCAGCCTCTGCTGCTTGCTGCATCCCTTGTCTCCGTAACATCAGCAGCGGGTCG
CAGTCTGCGACATGTAGGCAAGTCAGATGCTATCCTGAACAGCTTCCATAACCGCGCGCCCTACGCCAGCGAGCTGGATG
AGCGTCTGGAGCAGCGCACAACCTCCAAGGACTTCCTCTTCCTCAACAACAAGACCTCCAGTAAGATTGCCCTTGTTTCT
CTTTCCGCGTCGTCTACATCCTAACACCCCCCTTAAAGGCTATGCCGTCGATGGTACAGCCATTCCGGACGTCAGCTTTG
ACGTTGGCGAATCTTATGCTGGGTCGCTCCCCCTCTCCAGCAATGCCAGCGATCCGAATCAGCTGTTCTGGTGGTTCTTC
CCATCGGAAAACGAAGACGCGAAGAAGGAGATTGTGATTTGGCTCAATGGTGGCGTAAGTGCTGCCAACTTCAATTATTG
AAAGTTTGTGAATGTGTGGATCTGACCAATCTTCATTTAGCCGGGATGCTCTTCCCTCGAGGGCCTTCTCCAGGAAAACG
GCCCGTTCATTTGGCAGTATGGAACCTATTTGCCGGTGCAGAACACCTGGTCTTGGAACAAGCTCTCCAACATTGTCTAC
ATTGAGCAGCCCGTGGGCACCGGCTTCTCTGTCGGCACCCCAACCGCCACGAGCGAAGAGGATGTTGCCCGGCAGTTTCT
CGGCTTCTGGAAGAACTTTGCCCAGCTCTTCTCTCTCCAGGGCTACAAGGTCTACATCGCTGGCGAGTCTTATGCGTATG
TTCATCGTTCCTGTTTCTCAACCTGTCATCACCTGTCATCACCTGTCATCAGGCAACTAACAAAGACTAGTGGAATGTAC
TGCCCGTACATTGCGGCCGCTATGGTTGATGCTAATGACACGACCTACTACAATCTGAATGGCGTCATGATCTACGACCC
CGTCATCGGCTACAACGATATCCAGAACACCATTGTAGCCACCCCATTTGTCGACTACTGGCCGGGCCTGTTTCCTTTCA
ACGACAGCTTTGTCGCCGATATCCACAACCGCAGTGATAGCTGCGGCTACTCAGACTACTTGAGCAAATACCTCGTCTAC
CCCCCTTCAGGGCAGCAGCCAACGATCCTTCCCGGCCAGGACAGCACTGGAACAACTTACGACGACTGCGAAAACATCTA
CAACGACATTATCGGCGCTGCTCTGCTGGTGAACCCTTGCTGGGATATCTACCAAGTCGCCACGACCTGCCCCCTGCTGT
GGGATGTTCTTGGCTGTAAGACTGGCTCCTGCCCTCCAATCGCCGTGATTTCTAAAGCTTACAACTTTTTGGTATTAGTC
CCCGGTACGCTTGGCTATTTGCCAGATGGAGCACAGCTCTACTTCGACCGTGACGATGTCAAGAAGGCCATCCACGCGCC
CAACATGACTTGGGCAGAGTGCACGGATGTCAATGTCTTTGTTGACGGCACTGACACGTCTGTTCCGTCTGGCCTGTCGG
TTCTGCCAAAGGTCATCGACGCTACCAAGAACGTCATCATCGGTCATGGCGCTCTTGATTTTGTGCTGATCGCAAACGGA
ACCCTCTTGACCATCCAGAACATGACCTGGGGTGGAAAGCTTGGCTTCCAGTCGCCGCCGACCGAGCCTTTGTTCGTCCC
ATACCACGACGACCCGGTCGAGGCCTCGATGGCCGGCAGCGGTATTCTGGGCACTGCCCATACCGAGCGCGGCCTGACGT
ATGCGGCGGTCGATCTGTCCGGCCACATGATCCCACAGTACGCGCCCAGTGTGGCCTACCGCCAACTGGAGTTCCTCTTG
GGACGCGTCTCCAGCCTTTCGTCGACCGAGCCGTTCACCACAGATGCCAACGTCACACAGCCTACTGGTGATCTGGGCAA
CGGCAACGCTCCGCAGGGTTATGCCACTGTCAACAAGAAGAACGGCACTTCGTGCTCCATTTCTACTAGGACCAGCTCTG
CCGCCAGTGCTATTGTCACGAGCGAAGCGACGGCTAGGAGTCTGCCATTGGCCGCAAGCCTCTCTGCGGGACTCGCTCTT
CTTGTGACGCTGATGATTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62