GenePrediction:GLEAN_2853 Details

Name: GLEAN_2853
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3696448..3698682 (+ strand)
Length: 2235
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3696448..3696619 (+ strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_140:3696750..3697035 (+ strand)
Length: 286
Type: CDS
Source: GLEAN
Position: GCSC_140:3697089..3698344 (+ strand)
Length: 1256
Type: CDS
Source: GLEAN
Position: GCSC_140:3698591..3698682 (+ strand)
Length: 92
>GLEAN_2853 class=GenePrediction position=GCSC_140:3696448..3698682 (+ strand)
ATGTCGTCCTCGGTATACTTCAAGTTCAAGTCCCAGAAGGAACCTACCCGGGTCGAATTCGACGGCACCGGTATATCGGT
GTTTGAGCTCAAAAGGGATATAATTTTGAAGAGCGGCCTTGGAGACGGCACAGACTTCGACCTTGCCATTTACACAGAGG
ACGGGAAAGAAGGTAAGATAACTACGGAGGGGCTCACCATGATACAGCTCTTCAGGCTGTATAATGTGGTGCTGACTGCC
ACCGGCACTGTCCAAAGCTACATGTTATGTGTTTACTGATTATTTATGCTTTGATTGCTTAGAATACGATGATGACACTA
CTATCATTCCGCGTTCGACCACGGTAATTGCCCGTCGGCTGCCGCCGATGAAGCCTGGCGCCGGCCGTGCTGCAAGATAC
GTGTCGGGCAAGATGCCTGTGAACGCGAAAAATGCATCGCGCCGGGAGCAGACTGCCAAGGCCACTGCCAAGGCGACCTC
GAACGCCATTGAGCAGATGAACAATGCCATGACGGAGGATGAGAAGCTGGCAGCGATGTTCGCCGCCCAGTCAGAGCAAT
GGAACGCGCAGCAGGAAGAGATGTCGCAGTAAGTTTCATACTATGAGACTTTGGAAGTTCAACAGCTAACGTGTATTGCA
GTCAAACTCCCATCTTCAAGCCTGGAACTCGGCGTCCGGCTAACGTTCCAGACCATGACCCTCCTCAGGGCTACATTTGT
TACCGGTGCGGTGAGAAGGGTCATTGGATCCAGCTGTGTCCTACCAACGACAATCCGGAATACGATAACCGGCCACGGGT
GAAGCGCACGACTGGCATACCGAGGTCCTTTTTGAAAACGGTCGACAAGGCGGCCGTGCTGGCACAGGCTGCTGACGAAG
ACACGAAGGCGCCGTCTGGCATCATGGTCAACGCTGACGGCGATTTTGTGATCGCCGAACCGGACAAGGCATCCTGGGAT
AAGTTTCAAGCCCAGACGAAGTCTGCTGCCGCCGCTCAGGAAGTGGCGGCACGGGCGGACAAAGCGCTGCAGGAGCTTGG
GTTGGAATGCCCAATCGACAACAAGCTGTTCCTCGAACCAATGAAAACTCCGTGCTGTGGCAAGACATTCTGCAATGATT
GTATCACCAATGCGCTATTCGAGAGCGATTTCGTCTGTCCCAGCTGCCAGACGGAGGGTGTACTTATCGATGATTTGAAG
CCGGACGACGAGGTCGAGGGAAAGATCCAGACGTATCAAAAGGAAAAAGAGGCGAGCCAGAAGAAGACCGAGGAAGAGGG
CGAAGATGGCATCGAGGAGGCTGCAAGACGATCCCCTAGCACGGCGGCAGCGTCGCCCGCGGATGCAAAGCCAGCTGCTG
ATGGTGATGATCAGGGGAAGAAGTCGCCCCTTGCCGGAGCCACTGTAGCGGTCTCGACCACGAGCGCGACAAGCGCACCA
TCGCCGACGGCATCCCAGCAATCGGGTTCCGACAGCGGTGCTGCGTCTACAGGCGGGCAGTCAAACCCGAAAAAACGACC
GGCAGAAGACGAAGCTGAAAATCCTGCGATACCGAAAGCACCTAAAGCGATGCAGCAGCAACAGCAGGCACAACAACAGG
CGCTGCAGCAGCAGATGGCCGGTAATGGCATGGGTGGATTTAGCATGAACGGCATGGGCGGGATGGGTGGATTGAACGGC
ATGACTGGCATGAACGGGATGGGTGGCATGAACGCAATGGCGGGTATGGGAATGGGCATGATGCCGTTTGGCGGTATGCC
GATGAATTACGGCATGGGCAACATGGCTAATATGGCCAATATGGGTGGCATGGGCATGGGCATGGGCAACATGAACATGA
TGAATCCTATGATGAACGGCATGGGGATGAACGCCAACGGTGGCGGCTATGGTGCAGGTATCAACAATTTTCAGCAAGGT
TGGGGGCAGATGAACATGAATGGGAACAACGGCTTTCAGCAGGGCTGGGGAAACATGAATGCCACCGGTGGAGGTTACAG
AAACGGCGGCTACATTAATCAGCACCAACAACAACTGCAGCAGCAGCATCAACAACAGCTTCAGCAGCAACAGCAACCGC
CGCAACCGCAGCGGTTCAGTGGCTTCCAGAACATCGTGGCAGCCAGCAGCGAAAACGTCGAAGAAGACGACGCCTATTTC
CGCAAGCCGATAAATCCCCACCGCCACTTCAACAAGCCGAAGCGGATACGTCCGAGTGACTATCGTGAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62