GenePrediction:GLEAN_285 Details

Name: GLEAN_285
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:770503..774497 (+ strand)
Length: 3995
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:770503..771989 (+ strand)
Length: 1487
Type: CDS
Source: GLEAN
Position: GCSC_167:772382..774497 (+ strand)
Length: 2116
>GLEAN_285 class=GenePrediction position=GCSC_167:770503..774497 (+ strand)
ATGGCGGCGGAAGACGGCTCCGACAGGATGAGCCTGGTACGCAAGCGGACAGATACGGAACTGATGCCACCGCCACCAGC
GCCGAAGCAGATAAAGCGGCCAAAGACTGTTCTTGACGAAGATACATACGCGGACGGACTGTCAAAAATCATCGCGCGCG
ACTTTTTCCCAGGCCTGGTCGAGTCGGAAACACAAAACGAGTATCTGGACGCGTTGGCCTCCAAGGACAATGCGTGGATC
TCAAGCGCCGGCCAGCGGCTGAAGGAGGCGATGACGCCCGGCCGACGACGACAACAGCGGATGCGGTCACAGACGCCGTC
TCTGCGCGGCTCCAGCGCAACGCCGGGACCTGGAGAGACGCCACGAAGCTATGCCGGCGACACACCGGCATCGACCTGTT
CAGAGCGAACGCCAGGCGGCGGCGGTGGTGGTGCCGGTGGCGATGATGGAGACAAAGCGGAGGAAGCAAACAAGGAAGCT
GTCAATGTGGACGTCAGTTTAGGGGCGTTTCAAGCCAGGTACACGAGCGAAGACAACGAGAGCTTCTACAAGCTGCTGGA
CCGACAGAACCAGAAACGGGCAGAGAAGCACGCGTGGCTGTGGGATGGCAACAAGCTGCCGTCCAAGATGCAGCTGAGGC
AGAAGGAGGTGGAGACAAAGCTGCTGGCATCGGGCAGCCAGCTGGTCGACGACGGCTTCAAGCGGGAGAGGCTGGCCATG
GGGAGCATCGACGAGCGGCCAGCGGCACCAGACTCGTGGCGGTTCTCAGCCAAGAACACGCTCATGTTCAGCGCTGAGGG
GATGGACGACGGGGTCGAGACGGTGGCGCAGCGCGCGCAGGCTGAGTCGCACGCACCGCCAAGGTCGATCGTCTACGCGA
ACACACGGCTTCCGGGGATGGGCTCTACACAAAGCAACGAGCGGGGGGTCATTCCGGTGGCAGTGCCGCCGTCGCCAACG
CTGTCGGCCGTGCGTGACGCCATTGCCGGCCGTCCACGACGCAGCGACCGGGACTCGACATCGGGGACGACGACGGTGAC
GGGAGGCGGCGAGACGCCACGCGTCAACGGGTACGCGTTTGTGGACGACGAACCGGACGAGGCCCCAGCAAGCGGCGAGT
CGGCCGAGCTGATGGCGCACTTTGGACGAGTCGACGCCGCTCCCAACCCGTTCCAGCTGCAGGCCAAGAGTAGGCGCGAG
GGCCTGCATCATCGCATGGTGGAGCGGATTGCACAGTCCAAGCGGACGTCAGCACGGGTAGGCCTGACGGGTCGCGTGGA
CGCCGCATCGCCGTCGTCGTCGCCGTACCCAAACAGCCCGCGGATGCGCGGCAATCTGACGCCGGCCGGCCAGCGGCTCT
GGAGCAAGATTGGCGGCAGCCGGCGAGACGACGCGGTGTCTGCGTTCAATGCTAGCGGGAGCGGACCGCGGAACCCAAGC
AAGGGCAGCCGGCGGGCAAGGCTCAGAGAACAGCGAAGCATTTATCGGTAGGGCAAGGAGGTACGGAGTATCTCGGCGTT
TATTTCTTTGGAAGGGGGTTGCGCGGTTCGACGGTGTACTTGTTTGCTGCGACAATATCGATACCCATAGTGCTGACCGG
CAGAGGCTGGACCTGCCATCACATGCATCTGGCGATAGTTTGATTGAAAAGGCAGCGGTTGCAGCGAGTACGGAGTAATA
GTCGAGTAGATGTGCCCGATAGCCCCGCTTTTAGGAGGCTCAGAATTTTAGAGCTCCAGAAGCTGCCGGCTTTTTTCTCG
ACCACAGCTTCGCACCAGCAAAGAGCAGCCCACGCCACGACATGATGACGTCGTTGTCGCGGTAGTTTCGTCGTTTCTGG
TTTTCTTTTGTCGCTTTCTGTTGCTGCTGGGGCACGCAGTATGAAGTTCCTGGATCTGGCAGCGGACCTGGCGGCCTTGG
CCACAGCATCCCGCTCGATTGCCACAAAACACGCAGCATTGCGGACACGCCAGCTAGACGTCCGGTTTTCTGACAACGGC
AGAGCCAAGGACGACGGCCGTCCGGCAGCATCGAACGAGTCCGTCGATAAAGGGCCTCGCGACAGCACAGCGCCGGACAG
CTCCTCCACAGCAGCTGTCGAGACATTGGTTGTTCCTGTGGCCGCTCCCGTGGTCGAGACCAGAGCTGAGCCGAGCGAAG
AGAGAGTCAGATCCGTCGATGCGGAAGAGCCGGTTCTGCCGACGTTTGCTAAGCGGTCGTCCCTCGGGCTCGCAGTGCCC
GTCAGCGTGCTTCGAGAGCGCCGACAGGCCGATGCACCGCCACCAACTTCCGGTGGGGTCTCGCGACCACATCCGCTGGA
CCCACGCTTCCAGAAGTCATACGCACCTGCAGGGGTAGCAACTGTGCGGCCGACGCTGGCAGACAGCATCAGCACGGATG
CGTTTCGAACAAGTGAGGCAAAGGTGGAGAAGGAGGAGACCCAGAAGCTGGAGGAAGCAGACACCATTGCCGAGGAGGCT
GTAGCCCCTTCAGAGCGTATATCGGAAGCATTGCTGAAACCAGAGCCATTGAGTTCAGAGCCAATCAGTTCACCCACTCC
ACGTCGCAAGTACGAGCTGAAGGAGTCGACGGTGCCAGCGTCACGACTGAGCCGGATGTGGAACTACGGCGGACTGGCAG
CAGGGATGCTGGGCGGCGCAGTGACCGAGACGATCAGCCGCAGCTTTGGAGGTGGAGGCGACAAGAGCGCGGACTCGGTG
CTGCTCAGCGCGGGCAACGTGGAGCGGCTGGTGGCGCGGCTGTCGCGGATGCGCGGAGCCGCCCTGAAGCTAGGGCAGAT
GCTGAGCATCCAGGACTCCAAGTCACTGCCAGGACCGCTGCAAGAGGTGCTGCAGCGGGTGCAGGACCGGGCAGACTACA
TGCCGGCGTGGCAGCGTGACCGGGTGCTGGCGACGAATCTGGGCGCCGACTGGCGACAGCGGTTCGACGAGTTTGACGAG
ACGCCGCTGGCGGCCGCATCGATCGGCCAGGTGCACCGGGCGACGCTGCGGACAGGCGATGGTGATGGCGCCGAAACGGT
CGAGGTGGCCGTCAAGATCCAGTTCCCGGGCGTGGCCGACTCGATCCACGCCGACCTCGACAACCTGGCCGTGCTGCTGA
CGGCCACGCGCATGTTGCCGCGCGGCCTCTACCTCGACAAGACCATCGCCAACGCACGCACGGAGCTGGCCTGGGAGTGC
GACTATACGCGCGAGGCTGCGTGTCTGCAGCGCTTCCGTGAATTGCTGACTAATGCCGGACCCGCGGCCGACGCGTTTGC
CGTGCCGGCCGTCTACGCCGAGGCATCCGGGCCGCAGGTCCTGACCATGTCGTTCATGCAGGGCGTCCCCGTGGCCCAGG
CTGCCTCGGGCCTGCCGCAAGAGGAGCGCGACTGGATCGGCACCCAGGTGCTGCGGCTGTGTCTGCTGGAGATCACGTGC
TTCGGCTTCATGCAGACAGACCCCAACTGGACCAACTTTCTGTTCGGCGCCCGGCCGCAGCGCCGGCTCGAGCTGCTCGA
CTTTGGTGCCGCCCGCGAGTATCCCCGCGTCTTTGTCCGGCAGTACGTCCGCCTGCTGGCCGCCGCCGCCCGCAACGACC
ATGCCGGCGTCCAGACCTGCTCGCGCGCCCTCGGCTACCTCACCGGCCACGAGAGCCGCGCCATGCTCGAGGCCCACACG
CAGTCGGTCCTCACGCTGGCGGAGCCGTTCCGCGCTGACTCGCCCGTCGTCTACGACTTTGACGGCCAGACCATCACCGA
CCGCGTGCGCTCCTTCATTCCCACCATGGTGCGCGAACGCCTCACCCCGCCGCCCGAGGAGACCTACAGCCTCCATCGCA
AGCTCAGTGGTGCCTTTCTCCTATGTGCACGCCTCGGCAGCCGCGTGCCCTGTCGGGCCCTGTTTGAAGATAGCATGCGG
CAGATGGAGGCCGCTCACGGGGAGGCCGAACTGGAGGGCGACGACCTCGAGGACAGACTCGATGACCAGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62