GenePrediction:GLEAN_2878 Details

Name: GLEAN_2878
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:3947814..3950597 (+ strand)
Length: 2784
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:3947814..3950312 (+ strand)
Length: 2499
Type: CDS
Source: GLEAN
Position: GCSC_140:3950568..3950597 (+ strand)
Length: 30
>GLEAN_2878 class=GenePrediction position=GCSC_140:3947814..3950597 (+ strand)
ATGGCCAAGCAGCGCAAATCCAAGCGACAGCTCGTGCGAGACGAGCGGCGCAAGAAGAAGCGCGAGAACGAACTGCAGGA
TGACGAGGCACGCGAGGACACGCGGGACGCAAAGCGACAGCGGATCCACGAGGACGGCATGGACCAGGTCAACGGCGGGA
ACCTGTACTATGAAGACGATGGGGATGGTAAGAGTGGTCCGCGAGATGGCGGACAAGAGTATGGTGGACGAGAGTATGCT
GTTCCACGACAGCGTGCTGGCCCACGAGAGTTTCCGGGCTCGCGAGAGTATCCCGAATCACGAGAATACCCCGGCCCAGA
ACATGCTGGCCCAGATTATGCTGGCACCGGGGATCCACGTGAGTTCTTTGGGCTGCTGAGCGAGGCTGAGCAGGAGTATT
TCCGCCGGGCCGACGAGCTGTTGGAGCTCAACGAGTTCGACACACCGGCTGAACGGCGGGTCTTCCTGGCCAACGTCTTC
CGCGAGGCCCGCGGCAAGGAGCTCAAGCTGGCCAGCAGTCAGTCGTGCTCGCGGCTGATGGAGCGGCTGATGCAGCTGGC
GACGACACGCCAGAAGAAGCGCCTGTTTGGCGCATTTTCCACCCACTTCATGACGCTCGTGAGCCATCGATTCGCCGGTC
ATTGCTGCGAGCAGCTCTTCCTGCAGTCGGCCCGTGCCGTTGGCAAAGAGGGCACGGCCGACGACGACGAAGACGAGGCC
GAGGCTGAGGCTGCCGACGATAACGACGATGGTAACGACAAGAACGACACGTCCATGGAGCAACACTTTTTGCTTGTGCT
CGACGAGCTTGAGCCCCACGTCTCCGCCCTACTGACCGACCGTTTCGGCTCTCACGCACTGCGCGTCCTGCTTGTCGTTC
TCTCCGGCCGGCCACTCGACCAGCTGGCCACTCGCACGATGATGCGCAGCCGCAAGAAGGAGGTCGTCACCGTGGCTGGC
GAGGAGGCCCGGAAGCGCGCAGCCGCCAGCGACGGCGACGCATCTACCACCAATGCCATAGCAAGCAGCTCGACCACCGC
ATCGGCTGCAGCTGTCCGCTCAGTCCCACCGTCTTTTGTCGCTGCCGTCCGCAAGATCCTTGCCGATATTGTGGCCGCTC
TCGATCCGGCTTCTCTGCGTGTCATGGCCACCCATCCGACCGGAAACCCAGTGCTGCAGCTGTTGCTCGAGCTCGAGATG
GGCGAGGAAAAGAAGACAAAGAAAGGAAAGGAGGCCAAGGAGGAGGATGACACTCTACTGGGCCGACTGCTGCCCGGTGC
CCCGGCCTCGCTGTCCGATCCGCAGTCACCCGCCGCCGAGCTCATCCGCACGCTCGTCTATGACCGCATCGGCTCCCGTC
TGCTGGAGACGCTGGTGAACAACAGCCCCGGACGGCTGTTCAAGGCACTGTACGCAAGCACGTTTGCGGCACAGGTTGAG
GCTGATGACGCCGATGAGAGCAGCAAGGAAAAGGACACCTCGACCTCCTTCGCCCGCCCCATGGCCGTTTACCTCCGCAA
TGACGTCGCCTGTTATCCGGCCATACGCGTGCTGGAGCGGCTGGGCCGTGACGAGCTAGTTGCCGTCATCACCCAGCAGA
TCCTGGCCGCGCCCACCGCCGCGTCCATGTCTGGCCGTACCGCCGCGCCTGCCGCCGTGGTGGCCCAGCTGGTCGAACGC
CAACGTTTCAGCGTGCTGCGGACTCTCTTTGTCCGGTGTGCCGCGCGTTCCGTCGACCAGACTGTGGTGCGCCAGCTGGT
CGAAGCCCTGCGTCAGGCCGTCGGAGCCGAGCGTCACAGCGACTCAGCCAAGCTGATCACCCGGCTGTGTCTGGGCGAAT
CCGATGGTGATGTCGACGAGTCGGAGAAGCTCCGTGGCGGCGACGTCAGGGATGAGAAGAAAGAAGCCGCTGCTGTGGCC
CACGGCTGTCTCCTAGTGACGGCCATGCAGGCCATTCCGGGTCCACCAGCCCAGGCCGTGCAGAAGTCGCTTCTGGCACT
GTCGAGTGAGCAGCTGGCACACTTGGCCACGGCCACGACGGCCTCAGCCGCTATCGTCATTACCGCCATTGCCGCCACCA
ACAGCGACAGCCACAGCCGCAGCCAAGCACCCGTGGTCAAGCAGCTGGTGGCCCGTCTGGTGCCTGCCTATCTGCAGCTG
GCAACATCGCCGTCTGGTCATGCTGTCCTGGTGGCCATTGTGCAGAGGCCGTCACGGGTGGCTGATGCCTCGGCAGGAGC
TTCGGGAGGAACACCAGCTGGAGCCTTTGTGGCCCATCTCGAGCTGCCCTTCCACCTGAAGGAGGCATTCGTGTCACAGC
TCTCGACACAAGAGGACACACTGCGGGCCTGCTGGCCTGGCCGCGTCGTGTGGCGGGCTTGGCGCATCGACCTCTGGCGC
AGCCGTCGTGCAGACTGGATCCGCTGGAGCAAGGCAGGCGAGCCCGAGGGGCTGCAGAAATCGACGGCACCCTTGGCGGC
GGCTGCCTGGAACCGTGTCGTCAGAGACCAGAAGAATGTAGAGGAAGACGTCGAGATGGAGAAGGGTGGAGAGGAGGAGA
AGGAGCTTGAGGAGCCTGAGGAGAAGAAGGACGAGGAAGACAAGGAGGACAAGGAGGAAAAGATGGAAATACGGGAGGAC
AAGGAGAAGAAGGAGAAAAAGGAGAAAAAAGAGAAGAAGGAAAAAAAGGAGAAAAAAGAGAAGAAGGAAAAGAAGGAGAA
AAAGAAGAAAGAGGAGAAAAAGCTGACAGAAAAGTTGGACGAAGAGGACGGTGAATCAACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62